SBP1, SBP1 (gene) Prunus avium

Gene Overview
Name SBP1
Gene Symbol SBP1
Type gene
Organism Prunus avium
Synonym S-RNase binding protein 1-like protein
Description NA
Comment SBP1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SBP1KC244430.1-SBP1.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-RNase binding proteinSBPPrunus aviumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KC244430.1-SBP1.m1 N/A KC244430.1

Sequence(s):
>KC244430.1-SBP1.m11020
atggctcttcctcaacaccactttcaacagcactacccaccccaacaacaacaacaatcttctaagtctttcagaaattt
gtacacaatcgacggtcagatgacgccggctgtggcctattacgaccccagcactttacaagatcactcgcagcatcccc
cttatgttccaccctttcatgtagtagggtttgcacctggtccggtcgctgcaacagacggcagtgataatggagctgat
ttgcaatggcaatatggcttcgaatccaaaaggaaaaaactcaaggaacaggatttcttggagaacaactcacagatatc
atctgttgagttactacaaccgagatcagtctccacgggcttgggcttgtcccttgacaatactagaatggcttctaccg
gcgactccgcgttgctgtcactcatcggggatgacgtggatcatgagctacaacgacaggatgctgagattgacaggttc
ctcaaggctcagggtgaccgattgcggcaaaatatcctggagaaggtccaagctacccaacttcaaactctctcggttgt
agaagaaaaagtccttcagaagctgcgagagaaagaagcagaagtggagagcattaacaagaagaatatggagcttgaag
agcgaatggaacagttgactgttgaagcaggtgcttggcaacagctcgccaggcgcaacgaaaacatgatatcatctcta
aggttcaatcttcagcatgtatatgcgcaaagtagagatagtaaagaaggatgtggtgacagtgaggtagatgatacagc
ttcttgctgcaatggccgtaccctcaattttgatatgttttgcaaggagaacaatgatgtgaaagagatgatgacttgca
aggcctgcagagtcaatgaagtgtgcatgcttctattaccttgtaagcatctttgcctatgtaaagattgtgaaagtaag
cttagccttcgtcctctgtgtcagtcctctaagtttatcggcatggaggtatatttataa
back to top