SDH1, SDH1 (gene) Malus x domestica

Gene Overview
Name SDH1
Gene Symbol SDH1
Type gene
Organism Malus x domestica
Synonym NAD-dependent sorbitol dehydrogenase 1
sorbitol dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SDH1AY244806.1-SDH1.m1Malus x domesticamRNA
SDH1AF323504.1-SDH1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
sorbitol dehydrogenaseSDHMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AY244806.1-SDH1.m1 Chr01:22284288..22286463
chr1:14157025..14159200
chr1:18063358..18065533
AY244806.1
predicted genes from whole genome assembly AF323504.1-SDH1.m1 Chr01:22284288..22286463
chr1:14157025..14159200
chr1:18063358..18065533
AF323504.1

Sequence(s):
>AY244806.1-SDH1.m11116
atgggaaagggaggcatgtctgatggagatcatgctgatcgctgttatggggaagcaataaatggtgatgttcaacaaga
gaacatggctgcttggcttcttggtgttaaaaacctcaagattcaaccttacaagcttcctaatcttggaccccatgatg
ttagagtccggctgaaggctgttggcatatgtggcagtgatgttcaccacttcaagaacatgaggtgtgtagattttata
gttaaagagccaatggttattgggcatgagtgtgctgggatcatagaggaagttgggagtgaggtcgaggatttggtgcc
aggcgatcgtgtggcactagagcctggtatcagttgcaagcgatgcaacctctgcaaacaaggccggtacaatctatgcc
gcaagatgaagttttttggctcccctccaaataatggttgtctggcaaatcaggttgtccatccaggagatctatgtttt
aaactgccagacaatgtgagtttggaggaaggcgcgatgtgtgagcccttaagtgttggtattcatgcttgtcgccgggc
aaatgtctgtcaagaaacaaatgccttggtcgtgggagcaggacctataggacttgttacactgctagccgctcgtgctt
ttggggcgccccgaattgtcattgcggatgtgaatgacgagcgtttgttgattgcaaagagtcttggcgcagatgaagtc
gttaaggtttcaacaaatattgaggatgtagctgaagaagtggctaagatacaaaaggttttggaaaatggagtggatgt
aaccttcgactgtgcaggctttaacaaaaccataacaacagctttgagtgctactcgtcccggaggcaaagtttgccttg
tgggaatgggtcagagagagatgactctccctctcgctaccagagagattgatgtaattggaattttccgataccagaac
acatggccgctgtgccttgagtttctgagaagtggtaagattgatgtgaagcccctcataacacatcggtttggattttc
tcagaaggaggtggaagaagcctttgaaaccagtgctcgcggaggcaatgccattaaggtcatgtttaacctgtaa
back to top
>AF323504.1-SDH1.m11116
atgggaaagggaggcatgtctgatggagatcatgctgatcgctgttgtggggaagcaataaatggtgatgttcaacaaga
gaacatggctgcttggcttcttggtgttaaaaacctcaagattcaaccttacaagctccctaatcttggaccccatgatg
ttagagtccggctgaaggctgttggcatatgtggcagtgatgttcaccacttcaagaacatgaggtgtgtagattttata
gttaaagagccaatggttattgggcatgagtgtgctgggatcatagaggaagttgggagtgaggtcgaggatttggtgcc
aggcgatcgtgtggcactagagcctggtatcagttgcaagcgatgcaacctctgcaaacaaggccggtacaatctatgcc
gcaagatgaagttttttggctcccctccaaataatggttgtctggcaaatcaggttgtccatccaggagatctatgtttt
aaactgccagacaatgtgagtttggaggaaggcgcgatgtgtgagcccttaagtgttggtattcatgcttgtcgccgggc
aaatgtctgtcaagaaacaaatgtcttggtcgtgggagcaggacctataggacttgttacactgctagccgctcgtgctt
ttggggcgccccgaattgtcattgcggatgtgaatcacgagcgtttgttgattgcaaagagtcttggcgcagatgcagtc
gttaaggtttcaacaaatattgaggatgtagctgaagaagtggctaagatacaaaaggttttggaaaatggagtggatgt
aaccttcgactgtgcaggctttaacaaaaccataacaacagctttgagtgctactcgtcccggaggcaaagtttgccttg
tgggaatgggtcagagagagatgactctccctctcgctaccagagagattgatgtaattggaattttccgataccagaac
acatggccgctgtgccttgagtttctgagaagtggtaagattgatgtgaagcccctcataacacatcggtttggattttc
tcagaaggaggtggaagaagcctttgaaaccagtgctcgcggaggcaatgccattaaggtcatgtttaacctgtaa
back to top