SDH2, SDH2 (gene) Malus x domestica

Gene Overview
Name SDH2
Gene Symbol SDH2
Type gene
Organism Malus x domestica
Synonym NAD-dependent sorbitol dehydrogenase 2
sorbitol dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SDH2AY244808.1-SDH2.m1Malus x domesticamRNA
SDH2AY244807.1-SDH2.m1Malus x domesticamRNA
SDH2AF323505.1-SDH2.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
sorbitol dehydrogenaseSDHMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AY244808.1-SDH2.m1 Chr01:29359068..29360170
chr1:25157581..25158683
chr1:31460619..31461721
AY244808.1
predicted genes from whole genome assembly AY244807.1-SDH2.m1 Chr01:29358968..29360208
chr1:25157543..25158783
chr1:31460519..31461759
AY244807.1
predicted genes from whole genome assembly AF323505.1-SDH2.m1 Chr01:29358968..29360208
chr1:25157543..25158783
chr1:31460519..31461759
AF323505.1

Sequence(s):
>AY244808.1-SDH2.m1968
agatcctacctttcaagctccccgctattggaccgaatgatgttcgaattcggattaaggctgttggcatttgcggaagt
gatattcactacctcaagaccatgaaatgtggggattttcaggttaaggatccgatggtgatcggacatgagtgtgctgg
gatcgtagacaaagttgggagcgaggtgaagcatctggtgcctggtgaccgtgtggctgttgagcccggcatcagctgcg
cacattgccagcagtgcaagggcggccgctacaatctatgccctgacatgaagtttttcgccaccccacctgttcatggt
tcattggcgaatcagattgtgcaccccgcggatctgtgctttaaattgccggaaaatgtgagcttggaagaaggggcaat
gtgtgagcccttgagtgttggggttcacgcttgtcggcgagccaatgttggtcccgaaacaactgttctgatcgtcggcg
cagggccgatcgggctggtttccgtgctggctgctcgtgctttcggagcaccaagaattgtcatcgtagatatggatgac
aggcgtttagccatggcaaagtctctcggcgccgatggcacggtcaaagtttcgacaaaaatggaggatttagatgacga
agttgccaagattaaagaagctatgggatccgaagttgatgtgaccttcgactgtgttggcttcaacaaaaccatgtcta
cgggcctcaatgccactcgtcctggcggcaaagtttgccttgtcggaatgggacacggggtgatgacagtccctctcact
ccggctgctgccagggaggttgacgtggttggagtttttcgttacaagaacacatggccgctttgccttgagtttttgag
aagcgggaagatcgacgtgaagccgcttattacccaccggtttggttttaccgagaaggaggtggaagaagctttggaac
cagtgctc
back to top
>AY244807.1-SDH2.m11107
atgggtaagggaggccaatcctgcaatggcgtggttagagacgccaaacctgttgagcaggaaaacatggctgcctggct
agttgatgttaacaccatcaagatcctacctttcaagctccccgctattggaccgaatgatgttcgaattcggattaagg
ctgttggcatttgcggaagtgatattcactacctcaagaccatgaaatgtggggattttcaggttaaggatccgatggtg
atcggacatgagtgtgctgggatcgtagacaaagttgggagcgaggtgaagcatctggtgcctggtgaccgtgtggctgt
tgagcccggcatcagctgcgcacattgccagcagtgcaagggcggccgctacaatctatgccctgacatgaagtttttcg
ccaccccacctgttcatggttcattggcgaatcagattgtgcaccccgcggatctgtgctttaaattgccggaaaatgtg
agcttggaagaaggggcaatgtgtgagcccttgagtgttggggttcacgcttgtcggcgagccaatgttggtcccgaaac
aactgttctgatcgtcggcgcagggccgatcgggctggtttccgtgctggctgctcgtgctttcggagcaccaagaattg
tcatcgtagatatggatgacaggcgtttagccatggcaaagtctctcggcgccgatggcacggtcaaagtttcgacaaaa
atggaggatttagatgacgaagttgccaagattaaagaagctatgggatccgaagttgatgtgaccttcgactgtgttgg
cttcaacaaaaccatgtctacgggcctcaatgccactcgtcctggcggcaaagtctgccttgtcggaatgggacacgggg
tgatgacagtccctctcactccggctgctgccagggaggttgacgtggttggagtttttcgttacaagaacacatggccg
ctttgccttgagtttttgagaagcgggaagatcgacgtgaagccgcttattacccaccggtttggttttaccgagaagga
ggtggaagaagcttttgcaaccagtgctcgggggggcaacgccattaaagtcatgtttactctatag
back to top
>AF323505.1-SDH2.m11107
atgggtaagggaggccaatcctgcaatggcgtggttagagacgccaaacctgttgagcaggaaaacatggctgtctggct
agttgatgttaacaccatcaagatcctacctttcaagctccccgctattggaccgaatgatgttcgaattcggattaagg
ctgttggcatttgcggaagtgatattcactacctcaagaccatgaaatgtggggattttcaggttaaggatccgatggtg
atcggacatgagtgtgctgggatcgtagacaaagttgggagcaaggtgaagcatctggtgcctggtgaccgtgtggctgt
tgagcccggcatcagctgcgcacattgccagcagtgcaaaggcggccgctacaatctatgtttcgacatgaagtttttcg
ccaccccacctgttcatggttcattggcgaatcagattgtgcaccccgcggatctgtgctttaaattgccggaaaatgtg
agcttggaagaaggggcaatgtgtgagcccttgagtgttggggttcacccgtttcggcgagccaatgttggtcccgaaac
aactgttctgatcgtcggcgcagggccgatcgggctggtttccgtgctggctgctcgtgctttcggagcaccaagaattg
tcatcgtagatatggatgacaggcgtttagccatggcaaagtctctcgggcccgatggcacggtcaaagtttcgacaaaa
atggaggatttagatgacgaacttgccaagattaaagaagctatgggatccgaagttgatgtgaccttcgactgtgttgg
cttcaacaaaaccatgtctacgggcctcaatgccactcgtcctggcggcaaagtttgccttgtcggaatgggacacgggg
tgacgacggtccctctcactccggctgctgccagggaggttgacgtggttggagtttttgcttacaagaacacatggccg
ctttgcctagagtttttgagaagcgggaagatcgacgtgaagccgcttattacccaccggtttggttttaccgagaagga
ggtggaagaagcttttgcaaccagtgctcgggggggcaacgccattaaagtcatgtttactctatag
back to top