SDH6, SDH6 (gene) Malus x domestica

Gene Overview
Name SDH6
Gene Symbol SDH6
Type gene
Organism Malus x domestica
Synonym NAD-dependent sorbitol dehydrogenase 6
sorbitol dehydrogenase
Description NA
Comment SDH
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SDH6AY244814.1-SDH6.m1Malus x domesticamRNA
SDH6AY849316.1-SDH6.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
sorbitol dehydrogenaseSDHMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AY244814.1-SDH6.m1 Chr01:29359068..29368801
chr1:25181030..25182403
chr1:25177387..25178774
chr1:25148971..25158683
unanchored:21356154..21357380
chr1:31460619..31470331
chr1:31445027..31480127
AY244814.1
predicted genes from whole genome assembly AY849316.1-SDH6.m1 Chr00:814626..815872
chr7:23301489..23302735
chr7:27853680..27854926
AY849316.1

Sequence(s):
>AY244814.1-SDH6.m1959
agatcctacctttcaagctccccgctattggacccaatgatgtccggattcggattaaggcggttggtatttgtggaagc
gatgttcactacctcaggaccatgaaatgtgcggattttgaggttaaagaaccgatggtgatcggacatgagtgtgctgg
gatcgtagacaaagttgggagcgaggtgaagcatctggtgcctggtgaccgggtggcggttgagcccggtatcagttgct
cacggtgtcagcagtgcaaaggagggcagtacaatctttgccccgacatgaagtttttcgccaccccaccggttcatggt
tccttggcaaatcagattgtgcatcctgcggatctatgcttcaagctgccagagaatgtgagcttggaggaaggggcaat
gtgcgagcccttgagtgttggagttcatgcatgtcggcgagccaatgttggtcccgaaacaactgttctgatcatcggag
cagggcctattggtctggtttcagttttggccgctcttgctttcggggcaccaagaattgtcattgtggatatggacgac
aagcgtttagccatggcaaagtctctcggcgctgatggcaccgtcaaagtttcaacaaaaatggaggatttggatgacga
agttgccaagattaaagaagcaatggaatcggaggtggatgtgacctttgattgtgtgggttttaataaaaccatgtcga
cgggtctcaacgccacacgccccggcggcaaagtctgccttgtcggaatgggacacggcatgatgacagtgcctctcact
ccagctgctgccagggaggttgatgtggttggtgttttccggtgcaagaacacatggccactttgcctcgagtttttgag
aagtgggaagatcgacgtgaagccgcttattactcaccggtttggatttaccgagaaggaggtggaagaagcaagcttg
back to top
>AY849316.1-SDH6.m11107
atgggcaagggaggccaatcctgcaatggcatggttagacaagccaaacctgttgagcaggaaaacatggctgcttggct
tgttgatgtcaacaccatcaagatcctacctttcaagctccccagtatcggacccaatgatgttcgaattcggatcaagg
ctgtcggcatttgtggaagtgatgttcactacctcaagaccatgaaatgcgcggattttgaggttaaagagccaatggta
atcggacatgagtgtgccgggatcgtagacaaagttgggagcgaggtgaagcatttggtgcctggtgaccgcgtggcggt
agagcctggcatcagctgcgcacggtgccagcagtgcaagggaggccgctataatctttgccctgatatgaagtttttcg
ccaccccaccggttcatggttccttggctaatcagattgtgcaccctgcggatctgtgctttaaattgccggaaaacgtg
agtttggaggaaggggcaatgtgtgagcccttgagtgttggggttcacgcttgtcggcgagccaatgttggtcccgagac
aactgtcctgatcatcggtgcagggcctattggtctcgtttcagttttagccgctcgtgctttcggggcaccaagaattg
tgattgtggatatggatgacaagcgtctagcaatggcaaagtctctcggtgctgatgaggccgtgaaagtttcgacaaaa
atggaggatttagatgatgaagttgccgaaattaaagaagccatgatctccgaagtggatgtgaccttcgattgtgtggg
tttcaacaaaaccatgtcgaccggcctcaatgctactcgtcccggcggaaaagtctgccttgtaggaatgggacacggcg
tgatgacggtgcctctgactcccgctgctgctagggaggttgacgttgttggagttttccgataccagaacacatggcct
ctttgcctcgagtttttgagaagtgggaagattgacgtgaagccgcttatcacacaccgttttggatttactgagaagga
ggtggaagaagcgtttgcaacaagtgctcgtgggggtaatgccatcaaggtgatgttcaaattgtaa
back to top