SDH8, SDH8 (gene) Malus x domestica

Gene Overview
Name SDH8
Gene Symbol SDH8
Type gene
Organism Malus x domestica
Synonym NAD-dependent sorbitol dehydrogenase 8
NAD-dependent sorbital dehydrogenase 8
Description NA
Comment NAD-SDH 8
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SDH8AY244812.1-SDH8.m1Malus x domesticamRNA
SDH8AY707458.1-SDH8.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
sorbitol dehydrogenaseSDHMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AY244812.1-SDH8.m1 N/A AY244812.1
predicted genes from whole genome assembly AY707458.1-SDH8.m1 Chr01:29359329..29359706
chr1:25158045..25158422
chr1:31460880..31461257
AY707458.1

Sequence(s):
>AY244812.1-SDH8.m1965
agatcctacctttcaagctccccgctattggacccaatgatgttcgaattcggatcaaggctgtcggcatttgtggaagt
gatgttcactacctcaagaccatgaaatgcgcggattttgaggttaaagagccaatggtaatcggacatgagtgtgccgg
gatcgtagacaaagttgggagcgaggtgaagcatttggtgcctggtgaccgcgtggcggtagagcctggcatcagctgcg
cacggtgccagcagtgcaaaggaggccgctataatctttgccctgatatgaagtttttcgccaccccaccggttcatggt
tccttggctaatcagattgtgcaccctgcagatctttgctttaaattgccaaaaaacgtgagtttggaggaaggggcaat
gtgtgagcccttgagtattggggttcacgcttgtcggcgagccaatgttggtcccgaaacaactgttctgatcaccggag
cagggcctattggtctcgtttcagttttagccgctcgtgctttcggggcaccaagaattgtgattgtggatatggatgac
aagcgtctagcaatggcaaagtctctcggtgctgatgaaaccgtgaaagtttcgacaaaaatggaggacttagatgatga
agttgctgaaattaaaaaagcaatggaatcggaggtggatgtgacctttgattgtgtgggttttaataaaaccatgtcga
cgggtctcaacgccacacgccccggcggcaaagtctgccttgtcggaatgggacacggcatgatgacagtgcctctcact
ccagctgctgccagggaggttgatgtggttggtgttttccggtacaagaacacatggccactttgcctcgagtttttgag
aagtgggaagatcgacgtgaaaccgcttatcacgcaccgttttggattcacggagaaggaggtggaagaagcaagcttgg
aattc
back to top
>AY707458.1-SDH8.m1377
gagccgatggtgatcggacatgagtgtgctgggatcgtagacaaagttgggagcgaggtgaagcatctggtgcctggtga
ccgtgtggctgttgagcccggcatcagctgcgcacattgccagcagtgcaagggcggccgctacaatctatgccctgaca
tgaagtttttcgccaccccacctgttcatggttcattggcgaatcagattgtgcaccccgcggatctgtgctttaaattg
ccggaaaatgtgagcttggaagaaggggcaatgtgtgagcccttgagtgttggggttcacgcttgtcggcgagccaatgt
tggtcccgaaacaactgttctgatcgtcggcgcagggccgattgggctggtttccgt
back to top