SDH9, SDH9 (gene) Malus x domestica

Gene Overview
Name SDH9
Gene Symbol SDH9
Type gene
Organism Malus x domestica
Synonym NAD-dependent sorbitol dehydrogenase 9
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SDH9AY244810.1-SDH9.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
sorbitol dehydrogenaseSDHMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AY244810.1-SDH9.m1 Chr00:814626..815872
chr7:23301489..23302735
chr7:27853680..27854926
AY244810.1

Sequence(s):
>AY244810.1-SDH9.m11107
atgggcaagggaggccaatcctgcaatggcatggttagacaagccaaacctgttgagcaggaaaacatggctgcttggct
tgttgatgtcaacaccatcaagatcctacctttcaagctccccagtatcggacccaatgatgttcgaattcggatcaagg
ctgtcggcatttgtggaagtgatgttcactacctcaagaccatgaaatgcgcggattttgaggttaaagagccaatggta
atcggacatgagtgtgccgggatcgtagacaaagttgggagcgaggtgaagcatttggtgcctggtgaccgcgtggcggt
agagcctggcatcagctgcgcacggtgccagcagtgcaagggaggccgctataatctttgccctgatatgaagtttttcg
ccacccccccggttcatggttccttggctaatcagattgtgcaccctgcggatctgtgctttaaattgccggaaaacgtg
agtttggaggaaggggcaatgtgtgagcccttgagtgttggggttcacgcttgtcggcgagccaatgttggtcccgagac
aactgtcctgatcatcggagcagggcctattggtctcgtttcagttttaaccgctcgtgctttcggggcaccaagaattg
tgattgtggatatggatgacaagcgtctagcaatggcaaagtctctcggtgctgatgaagccgtgaaagtttcgacaaaa
atggaggatttagatgatgaagttgccgaaattaaaaaagccatgatctccgaagtggatgtgaccttcgattgtgtggg
tttcaacaaaaccatgtcgaccggcctcaatgctactcgtcccggcggaaaagtctgccttgtaggaatgggacacggtg
tgatgacggtgcctctgactcccgctgctgctagggaggttgacgttgttggagttttccgataccagaacacatggccg
ctttgcctcgagtttttgagaagtgggaagattgacgtgaagccgcttatcacacaccgttttggatttactgagaagga
ggtggaagaagcgtttgcaacaagtgctcgtgggggtaatgccatcaaggtgatgttcaaattgtaa
back to top