SDH, SDH (gene) Eriobotrya japonica

Gene Overview
Name SDH
Gene Symbol SDH
Type gene
Organism Eriobotrya japonica
Synonym NAD-dependent sorbitol dehydrogenase
NAD-SDH
Description NA
Comment NAD-SDH
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SDHFJ485729.1-SDH.m1Eriobotrya japonicamRNA
SDHFJ481648.1-SDH.m1Eriobotrya japonicamRNA
SDHAB042810.1-SDH.m1Eriobotrya japonicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
sorbitol dehydrogenaseSDHEriobotrya japonicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database FJ485729.1-SDH.m1 N/A FJ485729.1
mRNA parsed from NCBI nr database FJ481648.1-SDH.m1 N/A FJ481648.1
mRNA parsed from NCBI nr database AB042810.1-SDH.m1 N/A AB042810.1

Sequence(s):
>FJ485729.1-SDH.m1530
tggtcgtgggagcaggacctataggacttgttacactgctagccgctcgtgcttttggggcgccccgaattgtcattgcg
gatgtgaatgacgagcgtttgtcgattgcaaagagtcttggcgcggatgaagtcgttaaggtttcaacaaatattgagga
tttagctgaggaagtggctacgatacaaaaggttttggaaaatggagtggatgtaagcttcgactgtgcaggctttgaca
aaaccataacaacagctttgagtgctactcgtcccggaggcaaagtttgccttgtgggaatgggtcagagagagatgact
ctccctctcgcgaccagagagattgatgtaattggaattttccgataccagaacacatggccactgtgccttgagtttct
gagaagtggtaagattgatgtgaagcccctcataacgcatcggtttggattttctcagaaggaggtggaagaagcctttg
aaaccagtgctcgcggaggcaatgccattaaggtcatgtttaacctgtaa
back to top
>FJ481648.1-SDH.m1530
tggtcgtgggagcaggacctataggacttgttacactgctagccgctcgtgcttttggggcgcctcgaattgtcattgcg
gatgtgaatgacgagcgtttgtcgatagcaaagagtcttggcgcggatgaagtcgttaaggtttcaacaaatactgagga
tttagctgaggaagtggctacgatacaaaaggttttggaaaatggagtggatataagcttcgactgtgcaggctttgaca
aaaccataacaacagctttgagtgctactcgtcccggaggcaaagtttgccttgtgggaatgggtcagagagagatgact
ctccctctcgcgaccagagagattgatgtaattggaattttccgataccagaacacacggccactgtgccttgagtttct
gagaagtggtaagattgatgtgaagcccctcataacgcatcggtttggattttctcagaaggaggtggaagaagcctttg
aaaccagtgctcgcggaggcaatgccattaaggtcatgtttaacctgtaa
back to top
>AB042810.1-SDH.m11116
atgggaaagggaggcatgtctgatggagatcatgctgatcgctgttgtggggaagcaataaatggcgatgttcaacaaga
gaacatggctgcttggcttcttggtgttaaaaacctcaagattcaaccttacaagctccctaatcttggaccccatgatg
ttagagtccggctgaaggctgttggcatatgtggcagtgatgttcaccacttcaagaacatgaggtgtgtagattttata
gttaaagagccaatggttattgggcatgagtgtgctgggatcatagaggaagttgggagtgaggtcgaggatttggtgcc
aggcgatcgtgtggcactagagcctggtatcagttgcaagcgatgcaacctctgcaaacaaggccggtacaatctatgcc
gcaagatgaagttttttggttcccctccaaataatggttgtctggcaaatcaggttgtccatccaggagatctatgtttt
aaactgccagacaatgtgagtttggaggaaggcgcgatgtgtgagcccttaagtgttggtattcatgcttgtcgccgggc
aaatgtctgtcaagaaacaaatgtcttggtcgtgggagcaggacctataggacttgttacactgctagccgctcgtgctt
ttggggcgccccgaattgtcattgcggatgtgaatgacgagcgtttgtcgattgcaaagagtcttggcgcggatgaagtc
gttaaggtttcaacaaatattgaggatttagctgaggaagtggctacgatacaaaaggttttggaaaatggagtggatgt
aagcttcgactgtgcaggctttgacaaaaccataacaacagctttgagtgctactcgtcccggaggcaaagtttgccttg
tgggaatgggtcagagagagatgactctccctctcgcgaccagagagattgatgtaattggaattttccgataccagaac
acatggcccctgtgccttgagtttctgagaagtggtaagattgatgtgaagcccctcataacacatcggtttggattttc
tcagaaggaggtggaagaagcctttgaaaccagtgctcgcggaggcaatgccattaaggtcatgtttaacctgtaa
back to top