SDH, SDH (gene) Prunus persica

Gene Overview
Name SDH
Gene Symbol SDH
Type gene
Organism Prunus persica
Synonym NAD-dependent sorbitol dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
sorbitol dehydrogenaseSDHPrunus persicagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SDHAB025969.1-SDH.m1Prunus persicamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB025969.1-SDH.m1 scaffold_2:24766618..24768357
AB025969.1

Sequence(s):
>AB025969.1-SDH.m11104
atgggcaagggagggatgtcttctcagggaggggctctagaagcccatgttgaacaagaaaacatggctgcttggctggt
gggtgtgaacaccctcaggattcaacctttcaagctccctactgttggtcccaatgatgtcagagtcaagataaaggctg
ttgggatatgcggaagtgatgtccactaccttaagaccatgaaatgtgcagactttgttgttcaagagccaatggtaatt
gggcatgaatgtgctgggatcgttgacgaagttggtagcttggtgaagaatctggtgcccggagatcgcgtggctctaga
gcccggcatcagctgctggagatgtgagcagtgcaagggcgggcgatacaatctctgccctgacatgaagttcttcgcca
ccccaccagtccacggctcattggcaaatcagattgtgcaccctgcagatctgtgcttcaagctcccggagaatgtgagt
ttggaagaaggcgccatgtgcgagcctctgagtgttggtgttcatgcctgtcggcgagccaacatcggcccagaaacaaa
tgtcctggtgatcggagcagggccaatcgggcttgtgtcggtgctctctgctcgtgcttttggggcggccagaattgtca
ttgtggatgtggatgatgagcgcttatccattgcaaagtctctcggcgccgacgacgccgtcaaagtctccacaaaccct
caggatttagaagatgaagtttctaagataagtaaggccatgaaaggtggagtagatgtgagctttgactgcgtgggttt
taataaaactatgtcaacggccctcagcgccacccgtccgggcggcaaagtttgcctcgtgggcatgggtcacggcgtca
tgactgtccccctcacacctgccgctgccagggaagttgatgtggttggaatattccggtacaagaacacatggccgctg
tgcctcgagtttttgagaaccggtaagatcgatgtgaagcccctcataacgcaccgtttcggattctcccagaaggagat
tgaagaagccttcgaaaccagcgcgcgtggcggaaatgccataaaagtcatgtttaatttgtaa
back to top