SFB-2, SFB-2 (gene) Prunus tenella

Gene Overview
Name SFB-2
Gene Symbol SFB-2
Type gene
Organism Prunus tenella
Synonym SFB-2
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB-2KM276656.1-SFB-2.m1Prunus tenellamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus tenellagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KM276656.1-SFB-2.m1 N/A KM276656.1

Sequence(s):
>KM276656.1-SFB-2.m1900
gtctatctactctgcctccactaccccgatctcaaacgtcctttcgagttctacgaaaactacgtggactacccagatct
taaacgagaattggaatggtcacttttctccaacgaaacatttgagcattgctccaagttaaaccatcccttggggatca
agaaagattatagggtatatggctcgagcaatggcctagtttgcatttcggatgacaaattggacaccaagagccctata
cacatatggaacccctcggttaggaagtttagaacccttccaatgagcaccaaccacaacgttaaatttcgctacattgc
tctccaattcgggttccaccctggggttaatgactacaaggttgtaaggatgttgcgcgtccacaaagacgatgctttcg
cggtcgaagtttatagtctcagcacagactcttggaagatggttgaagaacatcctctttggttaaaatgcacttggcag
aaccatagaggtacattttataatggagtagcataccacattatcgagaaatttcctctattcagcattatgtcattcga
ttcgggcagcgaaaaattcgaagagttcatagcaccggatgccattagatgttggtcgcggctgtatattgaggtttaca
aggatcaaatttgcttgctttattatttgagattgtttcattgtgaggaagcaggcatgtcacaaattgagttttgggtt
ctgcaagaaaaacgatggaaacaaatgcgtccttttatttatccttccaacgactacttcgtagtcgggtttagcataga
taatgaactattaatggagaaaagcaattatggcaatgctttgtatttgtgcaactatgaatccaagcaagatcgtcaga
caggaattgagttggcagtc
back to top