SFB108, SFB108 (gene) Pyrus communis

Gene Overview
Name SFB108
Gene Symbol SFB108
Type gene
Organism Pyrus communis
Synonym SFB108
Description NA
Comment F-box
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB108EU247794.1-SFB108Pyrus communisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB108EU247794.1-SFB108.m1Pyrus communismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus communisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU247794.1-SFB108 N/A EU247794.1
mRNA parsed from NCBI nr database EU247794.1-SFB108.m1 N/A EU247794.1

Sequence(s):
>EU247794.1-SFB108911
ccaagtctctgatgagattcaaatgcatgcgcaagtcgtggtgcactctcatcaataatccaagttttgtgaccaaacac
ctcaacaattccgtggacaacaaactctcatcctccatttgtatttttctcgaccgttctcaggcgaacattttcccaga
ccagagttggaaacaagaagttttctggtccatgattaagctttccattgatagtgctgagcacaaccttcattatgatg
ttgaggacctaaatataccatttccattggaagatcacgattttgtattgatttttggttattgcaatggaattctctgt
gtagaagcaggaaaaatggttcttttatgcaatcctgcaacgagggaattcaggcaacttcccgtttcatgccttcttct
accccctcccaaggggaaatttcaattggaaacgacctttcaagcattgggatttggctatgattccaatgctgaagaat
acaaggttgtgcgaactatagaaaattgtgagtattcagatgatgagcaaacattttatcatcgtattgctcttcctcac
acggctgaggtatacaccacgacttcaaattcttggaaagagatcaagattgatatatcaagtgatacatatacatgttc
ttgttcagtgtacttgaagggattttgttattggtatgcaagggctggtgaggaatacatactttcatttcatgtaggtg
atgagacatttcatataatacaatttccttctaagagagaatccggttttacatttgattatatttttctccgaaatgat
tcccttgcttcttttcgctctcctcactatcctagtgaggattccaaattatttgaagtatgggtaatggacgattatga
tggggttaagagttcatggacaaaacaccta
back to top
>EU247794.1-SFB108.m1911
ccaagtctctgatgagattcaaatgcatgcgcaagtcgtggtgcactctcatcaataatccaagttttgtgaccaaacac
ctcaacaattccgtggacaacaaactctcatcctccatttgtatttttctcgaccgttctcaggcgaacattttcccaga
ccagagttggaaacaagaagttttctggtccatgattaagctttccattgatagtgctgagcacaaccttcattatgatg
ttgaggacctaaatataccatttccattggaagatcacgattttgtattgatttttggttattgcaatggaattctctgt
gtagaagcaggaaaaatggttcttttatgcaatcctgcaacgagggaattcaggcaacttcccgtttcatgccttcttct
accccctcccaaggggaaatttcaattggaaacgacctttcaagcattgggatttggctatgattccaatgctgaagaat
acaaggttgtgcgaactatagaaaattgtgagtattcagatgatgagcaaacattttatcatcgtattgctcttcctcac
acggctgaggtatacaccacgacttcaaattcttggaaagagatcaagattgatatatcaagtgatacatatacatgttc
ttgttcagtgtacttgaagggattttgttattggtatgcaagggctggtgaggaatacatactttcatttcatgtaggtg
atgagacatttcatataatacaatttccttctaagagagaatccggttttacatttgattatatttttctccgaaatgat
tcccttgcttcttttcgctctcctcactatcctagtgaggattccaaattatttgaagtatgggtaatggacgattatga
tggggttaagagttcatggacaaaacaccta
back to top