SFB12, SFB12 (gene) Prunus mume

Gene Overview
Name SFB12
Gene Symbol SFB12
Type gene
Organism Prunus mume
Synonym SFB12
Description NA
Comment PmSFB12
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB12JQ356586.1-SFB12Prunus mumegene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB12JQ356586.1-SFB12.m1Prunus mumemRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus mumegene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database JQ356586.1-SFB12 N/A JQ356586.1
mRNA parsed from NCBI nr database JQ356586.1-SFB12.m1 N/A JQ356586.1

Sequence(s):
>JQ356586.1-SFB12969
attcggtttctgtttacatgcaagtcatggagtgatttgattggcagctcgagctttgttagcatacacgttaacaggaa
tgtcacaaaacatgcccatgtccatttactctgcctccaccacccaaattttgaacgcccgaacgacaatgatgacccat
atgatatagaagaacttcaatggtcgcttttttccaatgaaacgtttgagcaattctccaagttgagccatcccttagaa
agcacagagcagtataggatatatggttcaagcaatggtttagtctgcatttcggatgagatattgaatttcgatagtcc
tatacacgtatggaacccatcggttaggaaatttaggacccctccaatgagcaccaacattaacatgaaattttcctatg
ttgctctccaattcgggttccaccctggggttaatgaccacaaggctgtaaggatgatgcgtaccaacaaaggtgccttg
gcagttgaggtatatagtcttagaacagactcttggaaaatgattgaaacaattcctccttggttaaaatgcacttggca
gcatcataagggtacattttttaatggagtagcataccacgtcattcaaaaaggacctatattcagcattatgtcattcg
attcaggcagtgaagaattcgaagaattcatagcaccagatcccatttgcagttcctggaagttatgcatcgacctttac
aaagaacatgtttgcttgctttttggattttatggttgtgaggaggagggcatggaaaaaactgacttatgggttctaaa
agaaaaacggtggaaacaactgtgtccttttatttatcctggggattattgttatcatgtagtcgggattagtatagata
atgaactcttaatggcaagaggaggtttcgatatgggcatagcagagctgtatttgtgtaattacgaatccaagcaagtt
cttgaaaca
back to top
>JQ356586.1-SFB12.m1969
attcggtttctgtttacatgcaagtcatggagtgatttgattggcagctcgagctttgttagcatacacgttaacaggaa
tgtcacaaaacatgcccatgtccatttactctgcctccaccacccaaattttgaacgcccgaacgacaatgatgacccat
atgatatagaagaacttcaatggtcgcttttttccaatgaaacgtttgagcaattctccaagttgagccatcccttagaa
agcacagagcagtataggatatatggttcaagcaatggtttagtctgcatttcggatgagatattgaatttcgatagtcc
tatacacgtatggaacccatcggttaggaaatttaggacccctccaatgagcaccaacattaacatgaaattttcctatg
ttgctctccaattcgggttccaccctggggttaatgaccacaaggctgtaaggatgatgcgtaccaacaaaggtgccttg
gcagttgaggtatatagtcttagaacagactcttggaaaatgattgaaacaattcctccttggttaaaatgcacttggca
gcatcataagggtacattttttaatggagtagcataccacgtcattcaaaaaggacctatattcagcattatgtcattcg
attcaggcagtgaagaattcgaagaattcatagcaccagatcccatttgcagttcctggaagttatgcatcgacctttac
aaagaacatgtttgcttgctttttggattttatggttgtgaggaggagggcatggaaaaaactgacttatgggttctaaa
agaaaaacggtggaaacaactgtgtccttttatttatcctggggattattgttatcatgtagtcgggattagtatagata
atgaactcttaatggcaagaggaggtttcgatatgggcatagcagagctgtatttgtgtaattacgaatccaagcaagtt
cttgaaaca
back to top