SFB1, SFB1 (gene) Prunus armeniaca

Gene Overview
Name SFB1
Gene Symbol SFB1
Type gene
Organism Prunus armeniaca
Synonym S-locus F-box protein 1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB1AY587563.1-SFB1Prunus armeniacagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB1AY587563.1-SFB1.m1Prunus armeniacamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus armeniacagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AY587563.1-SFB1 N/A AY587563.1
mRNA parsed from NCBI nr database AY587563.1-SFB1.m1 N/A AY587563.1

Sequence(s):
>AY587563.1-SFB11134
atggcattcacactacgcaagaaagaaatcttagtcgacatcctagtaagactacctgcaaaatctctcgttcggtttct
gtgtacatgcaagtcatggagtggtttgattggcagctcgagttttgttagcatacaccttaacaggaatgtcacagaac
atgcccatgtctatctactctgcctcctccacccaaattttgaacgtctggccgaccctgatgacccatatgttaaacaa
gagtttagctggtctcttttttcgaatgaaacatttgaggaaagctccaagataacccatcccttagggagcacagaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttcagatgagattttgaatttcgatagtcctatacacatat
ggaacccgtcggttaagaaatttaagacccctccaatgagcaccaacattaacattaaatttagcctcgtttctctccaa
ttcgggttccatcctagggttaatgactacaaggctgtaaggatgatgcgcaccaacaaaaatgtcttggcggttgaggt
ttatagtctcagcacagactcttggaaaatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacattttttaatggagtagcataccacatcattcagaaaggtcctctattcagcattatgtccttcgattcaggcagt
gaagaattcgaagaattcatagcaccagatgccatttgccgttcattggggttatgcatcgacgtttacaaggaacacat
ttgcttgctttttggattttatggttgtgaggaggagggcatggacaaaattgacttatgggttctgcaagagaaacggt
ggaaaaaattgtgtccttttatttatgatcctctggattattgttatcgtataattgggattggtatagataatgaactc
ttaatggaaacagaagatttccttaggggcgtaggatatctgcatttgtgtaataatgaatccaagcaagttcttgaaac
aggaattgagttggctgtcatgaaatatggcgaaatcgaattctcttacacaattacttacatagaaagcttggtttttc
tcgataaatattaa
back to top
>AY587563.1-SFB1.m11134
atggcattcacactacgcaagaaagaaatcttagtcgacatcctagtaagactacctgcaaaatctctcgttcggtttct
gtgtacatgcaagtcatggagtggtttgattggcagctcgagttttgttagcatacaccttaacaggaatgtcacagaac
atgcccatgtctatctactctgcctcctccacccaaattttgaacgtctggccgaccctgatgacccatatgttaaacaa
gagtttagctggtctcttttttcgaatgaaacatttgaggaaagctccaagataacccatcccttagggagcacagaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttcagatgagattttgaatttcgatagtcctatacacatat
ggaacccgtcggttaagaaatttaagacccctccaatgagcaccaacattaacattaaatttagcctcgtttctctccaa
ttcgggttccatcctagggttaatgactacaaggctgtaaggatgatgcgcaccaacaaaaatgtcttggcggttgaggt
ttatagtctcagcacagactcttggaaaatggttgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacattttttaatggagtagcataccacatcattcagaaaggtcctctattcagcattatgtccttcgattcaggcagt
gaagaattcgaagaattcatagcaccagatgccatttgccgttcattggggttatgcatcgacgtttacaaggaacacat
ttgcttgctttttggattttatggttgtgaggaggagggcatggacaaaattgacttatgggttctgcaagagaaacggt
ggaaaaaattgtgtccttttatttatgatcctctggattattgttatcgtataattgggattggtatagataatgaactc
ttaatggaaacagaagatttccttaggggcgtaggatatctgcatttgtgtaataatgaatccaagcaagttcttgaaac
aggaattgagttggctgtcatgaaatatggcgaaatcgaattctcttacacaattacttacatagaaagcttggtttttc
tcgataaatattaa
back to top