SFB1, SFB1 (gene) Prunus avium

Gene Overview
Name SFB1
Gene Symbol SFB1
Type gene
Organism Prunus avium
Synonym S locus F-box protein with the low allelic sequence polymorphism 1-S4
S haplotype-specific F-box protein 1
SLFL1-S2
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB1AB280953.1-SFB1Prunus aviumgene
SFB1AB111518.1-SFB1Prunus aviumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB1AB280953.1-SFB1.m1Prunus aviummRNA
SFB1AB111518.1-SFB1.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus aviumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB280953.1-SFB1 N/A AB280953.1
gene parsed from NCBI nr database AB111518.1-SFB1 N/A AB111518.1
mRNA parsed from NCBI nr database AB280953.1-SFB1.m1 N/A AB280953.1
mRNA parsed from NCBI nr database AB111518.1-SFB1.m1 N/A AB111518.1

Sequence(s):
>AB280953.1-SFB11224
atgtgggaagagatggcgttgcgccgtattctaccaagattgccttcaaaatctctaatgcggttcaagtgtgttcgtaa
atcatggtatactttgatcaacaatcccacgttcgtggaaaatcatctctctaattcgatgcacagcaaactgtctacct
gcgtccttttcagtcgttttgtccagagagacactaacagtgatgagaaggaacttgcattctccttcctttatctccga
aatgattatgatgatgatgagcataacgtcaattttgttgttgaggacatcaagtctccactttcttcgggacgatttat
tgggctcgaggatgtagaatctccaagtattttaggccattgtaatgggatagtttgtctaagtccttgtagtgacaacc
ttcttttatgcaatccaggaatcaaggaaatcaaacttctacccaaatcaggccttccagattggtggggatgtgctgtg
gggtttggatatgatcccaagtctaaagattacaaagttagtagaattgcatcttatcaggcggaaattgatggtcttat
tcctcctcctagagttgaaatatacaccctcagtactgattcttggcgagagatcaagaataattctttagaaacagata
ctacttgcttttttcccgattatttccagatgtacttccaaggaatttgttattgggtggggtatgagcaaccaaaacaa
tctgtggaatacgaggatgaggaacagaagccaatggtcattttcttcgacacgggtgatgaaatatttcatcatatatt
atttcctgatagtttttatatgtatgaggagggatcatcttatgcgtatgaaatgtcttatattatgtatactgatctgc
gcattatactgtggaatggatctattgctctttttggttttaatcgttttagtgtatttcctgactcctatggagtttgg
gtgttggatgactttgacggtgctaagggttcttggataaaacacttaacttttgagccattgatgggcattaagagggt
attggaattttggaagagtgacgagattcttatggttacagaagaagatggagatatagtatcgtacagccttgaaactg
agaagcttaagaatcttcccatgaatagcccatctgatttcgaaactattttgtatgtgaatagcttagttccaatcaca
ggaggcaacaagcttgagagttag
back to top
>AB111518.1-SFB11128
atggcatttacaatacgtaagaaagagatcttaatcgacatcctggtgagactacctacaaagtccatcgttcgatttct
gtggacgtgcaagtcatggagtgattttattggcagctcgagttttgttagcacacaccttgataggaatgtcacaaaac
atgcccatgtctatctactctgcctccaccacccaaattttgaatgtcacgtcgaccctgatgacccatatgttaaaaaa
gaatttcaatggtctctttttcccaatcaaacatgtgaggtgttctacaagttaagccatcccttagggaacacagaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaacttagaaccacaccaatcagcaccaacattaacatgaaatttagccttgtttctcttcaa
tttgggttccaccccgtggttaatgactataaggctgtacggatgatgcgtaccaacaaaggtgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattcaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacattttctaatggagtagcataccacatcattgagaaaggtcatataatcagcattatgtcatttaattcaggcagc
gaagaatttgaagagttcatagcaccagatgccgtttgtagttcatggaggtcatgcatcgaggtttacaaggaacaaat
ttgttgcttcttgactttatcctgtgaggaggagggcatggaaaaatttgacttgtgggttctgcaagaaaaacggtgga
aacaattgtgcccttttatttattcttcagattattgttatcgtacaatcgggattagtatagataatgaactcttaacg
gcaagaataggtttcgataagggtgtagcagatctgtgtttgtgtaattacgaaaccaatcaacttcttgaaacaggaat
taagttagccatcatgagatatggcgaaatcgaattcttgtttgcaattacttacatagaaagttctggtttactcaata
atcattaa
back to top
>AB280953.1-SFB1.m11224
atgtgggaagagatggcgttgcgccgtattctaccaagattgccttcaaaatctctaatgcggttcaagtgtgttcgtaa
atcatggtatactttgatcaacaatcccacgttcgtggaaaatcatctctctaattcgatgcacagcaaactgtctacct
gcgtccttttcagtcgttttgtccagagagacactaacagtgatgagaaggaacttgcattctccttcctttatctccga
aatgattatgatgatgatgagcataacgtcaattttgttgttgaggacatcaagtctccactttcttcgggacgatttat
tgggctcgaggatgtagaatctccaagtattttaggccattgtaatgggatagtttgtctaagtccttgtagtgacaacc
ttcttttatgcaatccaggaatcaaggaaatcaaacttctacccaaatcaggccttccagattggtggggatgtgctgtg
gggtttggatatgatcccaagtctaaagattacaaagttagtagaattgcatcttatcaggcggaaattgatggtcttat
tcctcctcctagagttgaaatatacaccctcagtactgattcttggcgagagatcaagaataattctttagaaacagata
ctacttgcttttttcccgattatttccagatgtacttccaaggaatttgttattgggtggggtatgagcaaccaaaacaa
tctgtggaatacgaggatgaggaacagaagccaatggtcattttcttcgacacgggtgatgaaatatttcatcatatatt
atttcctgatagtttttatatgtatgaggagggatcatcttatgcgtatgaaatgtcttatattatgtatactgatctgc
gcattatactgtggaatggatctattgctctttttggttttaatcgttttagtgtatttcctgactcctatggagtttgg
gtgttggatgactttgacggtgctaagggttcttggataaaacacttaacttttgagccattgatgggcattaagagggt
attggaattttggaagagtgacgagattcttatggttacagaagaagatggagatatagtatcgtacagccttgaaactg
agaagcttaagaatcttcccatgaatagcccatctgatttcgaaactattttgtatgtgaatagcttagttccaatcaca
ggaggcaacaagcttgagagttag
back to top
>AB111518.1-SFB1.m11128
atggcatttacaatacgtaagaaagagatcttaatcgacatcctggtgagactacctacaaagtccatcgttcgatttct
gtggacgtgcaagtcatggagtgattttattggcagctcgagttttgttagcacacaccttgataggaatgtcacaaaac
atgcccatgtctatctactctgcctccaccacccaaattttgaatgtcacgtcgaccctgatgacccatatgttaaaaaa
gaatttcaatggtctctttttcccaatcaaacatgtgaggtgttctacaagttaagccatcccttagggaacacagaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaacttagaaccacaccaatcagcaccaacattaacatgaaatttagccttgtttctcttcaa
tttgggttccaccccgtggttaatgactataaggctgtacggatgatgcgtaccaacaaaggtgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattcaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacattttctaatggagtagcataccacatcattgagaaaggtcatataatcagcattatgtcatttaattcaggcagc
gaagaatttgaagagttcatagcaccagatgccgtttgtagttcatggaggtcatgcatcgaggtttacaaggaacaaat
ttgttgcttcttgactttatcctgtgaggaggagggcatggaaaaatttgacttgtgggttctgcaagaaaaacggtgga
aacaattgtgcccttttatttattcttcagattattgttatcgtacaatcgggattagtatagataatgaactcttaacg
gcaagaataggtttcgataagggtgtagcagatctgtgtttgtgtaattacgaaaccaatcaacttcttgaaacaggaat
taagttagccatcatgagatatggcgaaatcgaattcttgtttgcaattacttacatagaaagttctggtttactcaata
atcattaa
back to top