SFB1, SFB1 (gene) Prunus cerasus

Gene Overview
Name SFB1
Gene Symbol SFB1
Type gene
Organism Prunus cerasus
Synonym truncated S haplotype-specific F-box protein 1'
S haplotype-specific F-box protein 1
SFB1'
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB1DQ827716.1-SFB1Prunus cerasusgene
SFB1DQ827715.1-SFB1Prunus cerasusgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB1DQ827716.1-SFB1.m1Prunus cerasusmRNA
SFB1DQ827715.1-SFB1.m1Prunus cerasusmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus cerasusgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ827716.1-SFB1 N/A DQ827716.1
gene parsed from NCBI nr database DQ827715.1-SFB1 N/A DQ827715.1
mRNA parsed from NCBI nr database DQ827716.1-SFB1.m1 N/A DQ827716.1
mRNA parsed from NCBI nr database DQ827715.1-SFB1.m1 N/A DQ827715.1

Sequence(s):
>DQ827716.1-SFB11746
atggcatttacaatacgtaagaaagaaatcttaatcgacatcctggtgagactacctacaaagtccctcgttcgatttct
gtgtacatgcaagtcatggagtgattttattggcagctcgagttttgttagcacacaccttgataggaatgtcacaaaac
atgcccatgtctatctactctgcctccaccacccaaattttgaatgtcacgtcgaccctgatgactaggggtgggcatcg
ggaccggaaaaccggaacaccgaaccgaatcggtgaaaaaaaaccggaaaaaaaaccggttgaccaaaaaagtcaacaaa
ccggaccggaccggaccgaaccggttccaaccggttccggttccggttttacactacaccgcaccggaccggaccgaacc
ggaccggtcatatttttttattttttttttattttttttattttttatttacaaatttttaaaatataatctcatatttt
aaatgttataatcactatagttcaacttcaaaaaatttctaaatgtatgaattggattatttgttaatttttaagccaaa
aaaataagttatttattataaatttttaattaaaaaaataaaaaaaaaaaaaatttttaaaaaaataaaaaaataattaa
aaaataaaaaattaataaaccggttcaaaaccggaaccggtcagaaccggaccggaaccggtcagaaccgaaccggccgg
tttttgaatttttttttacttaaaccggaccgaaccggaccggttaaatagtaccgatttcggttccggtttaaggtcag
aaccggaccgaaccggaccgcgcccacccctactgatgacccatatgttaaaaaagaatttcaatggtctctttttccca
atcaaacatgtgaggtgttctacaagttaagccatcccttagggaacacagaacattatgggatatatggttcaagcaat
ggtttagtttgcatttcggatgagatactgaatttcgatagtcctatacacatatggaacccatcggttaggaaacttag
aaccacaccaatcagcaccaacattaacatgaaatttagccttgtttctcttcaatttgggttccaccccgtggttaatg
actataaggctgtacggatgatgcgtaccaacaaaggtgccttggcggttgaggtttatagtcttagaacagactcttgg
aagatgattcaagcaattcctccttggttaaaatgcacttggcagcatcataagggtacattttctaatggagtagcata
ccacatcattgagaaaggtcatataatcagcattatgtcatttaattcaggcagcgaagaatttgaagagttcatagcac
cagatgccgtttgtagttcatggaggtcatgcatcgaggtttacaaggaacaaatttgtttgcttcttgacttttatcct
tgtgaggaggagggcatggaaaaatttgacttgtgggttctgcaagaaaaacggtggaaacaattgtgcccttttattta
ttcttcagattattgttatcgtacaatcgggattagtatagataatgaactcttaacggcaagaagaggtttcgataagg
gtgtagcagatctgtgtttgtgtaattacgaaaccaatcaacttcttgaaacaggaattaagttagccatcatgagatat
ggcgaaatcgaattcttgtttgcaattacttacatagaaagtttggttttactcaataatcattaa
back to top
>DQ827715.1-SFB11131
atggcatttacaatacgtaagaaagaaatcttaatcgacatcctggtgagactacctacaaagtccctcgttcgatttct
gtgtacatgcaagtcatggagtgattttattggcagctcgagttttgttagcacacaccttgataggaatgtcacaaaac
atgcccatgtctatctactctgcctccaccacccaaattttgaatgtcacgtcgaccctgatgacccatatgttaaaaaa
gaatttcaatggtctctttttcccaatcaaacatgtgaggtgttctacaagttaagccatcccttagggaacacagaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaacttagaaccacaccaatcagcaccaacattaacatgaaatttagccttgtttctcttcaa
tttgggttccaccccgtggttaatgactataaggctgtacggatgatgcgtaccaacaaaggtgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattcaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacattttctaatggagtagcataccacatcattgagaaaggtcatataatcagcattatgtcatttaattcaggcagc
gaagaatttgaagagttcatagcaccagatgccgtttgtagttcatggaggtcatgcatcgaggtttacaaggaacaaat
ttgtttgcttcttgacttttatccttgtgaggaggagggcatggaaaaatttgacttgtgggttctgcaagaaaaacggt
ggaaacaattgtgcccttttatttattcttcagattattgttatcgtacaatcgggattagtatagataatgaactctta
acggcaagaagaggtttcgataagggtgtagcagatctgtgtttgtgtaattacgaaaccaatcaacttcttgaaacagg
aattaagttagccatcatgagatatggcgaaatcgaattcttgtttgcaattacttacatagaaagtttggttttactca
ataatcattaa
back to top
>DQ827716.1-SFB1.m1228
atggcatttacaatacgtaagaaagaaatcttaatcgacatcctggtgagactacctacaaagtccctcgttcgatttct
gtgtacatgcaagtcatggagtgattttattggcagctcgagttttgttagcacacaccttgataggaatgtcacaaaac
atgcccatgtctatctactctgcctccaccacccaaattttgaatgtcacgtcgaccctgatgactag
back to top
>DQ827715.1-SFB1.m11131
atggcatttacaatacgtaagaaagaaatcttaatcgacatcctggtgagactacctacaaagtccctcgttcgatttct
gtgtacatgcaagtcatggagtgattttattggcagctcgagttttgttagcacacaccttgataggaatgtcacaaaac
atgcccatgtctatctactctgcctccaccacccaaattttgaatgtcacgtcgaccctgatgacccatatgttaaaaaa
gaatttcaatggtctctttttcccaatcaaacatgtgaggtgttctacaagttaagccatcccttagggaacacagaaca
ttatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatactgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaacttagaaccacaccaatcagcaccaacattaacatgaaatttagccttgtttctcttcaa
tttgggttccaccccgtggttaatgactataaggctgtacggatgatgcgtaccaacaaaggtgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattcaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacattttctaatggagtagcataccacatcattgagaaaggtcatataatcagcattatgtcatttaattcaggcagc
gaagaatttgaagagttcatagcaccagatgccgtttgtagttcatggaggtcatgcatcgaggtttacaaggaacaaat
ttgtttgcttcttgacttttatccttgtgaggaggagggcatggaaaaatttgacttgtgggttctgcaagaaaaacggt
ggaaacaattgtgcccttttatttattcttcagattattgttatcgtacaatcgggattagtatagataatgaactctta
acggcaagaagaggtttcgataagggtgtagcagatctgtgtttgtgtaattacgaaaccaatcaacttcttgaaacagg
aattaagttagccatcatgagatatggcgaaatcgaattcttgtttgcaattacttacatagaaagtttggttttactca
ataatcattaa
back to top