SFB1, SFB1 (gene) Prunus dulcis

Gene Overview
Name SFB1
Gene Symbol SFB1
Type gene
Organism Prunus dulcis
Synonym S locus F-box
Description NA
Comment PdSLF1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus dulcisgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB1DQ099896.1-SFB1.m1Prunus dulcismRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database DQ099896.1-SFB1.m1 N/A DQ099896.1

Sequence(s):
>DQ099896.1-SFB1.m11131
atgacattcatacaacttaagaaagagatcttaatcgacatcctagtgaggttacctgcaaaatcactcgttcgatttct
gtgtacatgcaagtcatggagtgattcgattggcagctcgagttttgttagcacacaccttcataggaacgtcacaaagc
attcccatgtctatctactctgcctccaccacccaaattttgaatgtgcggtcgatcctaatgacccatatatagaagaa
gaagttcaatggtctctgttttccaatgaaacatttgagcagtgctccaagttaagccatcccttagggagcacggaaca
ttatgtgatatatggttcaagcaatggtttagtttacatttcggatgagatattgaattttgatagtcctatacacatat
ggaacccatcggttaggaaacttagaacccctccaatcagcaccaacattaacattaaatttagctgtgttgctctccaa
ttcgggttccaccctgttgttaatgattacaaggctgtgaggatgatgcgtaccaacaaaggtgctttggcagttgaggt
ttatagtcttaaaacagactgttggaagatgattgaagcaattcctccttggttaaaatgctcttggcagcaccacgatc
gtacatttttcaatggagtagcataccacatcattgagaaaggtcctatattcagcattatgtccttcgattcaggcagt
gaagaatttgaagaattcatagcaccagatgccatttgcagtccatacgaggcatgtattgacgtttacaaggaacaaat
ttgcttgctttttgaattttatgattgtgaggaggagggcatggacaaaattgacttctgggttctgcaagaaaaacggt
ggaaacaattgtgtcctttcagttatcctttgggttattgttatcgtataaccgggattagtatagacaatgaactctta
atgggaagaagagatttcgctaagggcggagcagaattgtatatatgtaattacgaatccaagcaagttcttgaaacagg
aattaagttgggcagcatgacatatggggaaatcgaattcttgttttcaattacttatatagaaagtttagttttactca
ttaattattaa
back to top