SFB1, SFB1 (gene) Prunus webbii

Gene Overview
Name SFB1
Gene Symbol SFB1
Type gene
Organism Prunus webbii
Synonym S locus F-box protein
SLF
Description NA
Comment PwSFB1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB1DQ993667.1-SFB1Prunus webbiigene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB1DQ993667.1-SFB1.m1Prunus webbiimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus webbiigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ993667.1-SFB1 N/A DQ993667.1
mRNA parsed from NCBI nr database DQ993667.1-SFB1.m1 N/A DQ993667.1

Sequence(s):
>DQ993667.1-SFB11122
atgacattcacactacgcaagaaagaaatcttaatcgacatcctattaagactacctgcaaaatcccttgttcggtttct
gtgtacacgcaagtcttggaatgatctgattggcagctcaagttttgttagcacacacctcaacaggaatgtcacaaatc
atgcccatgtttatctactctgcctccaccacccaaatgttagacgccagttcaaccccgatgacccatatgttaaacaa
gaatgccaatggtctattttttcgaatgaaacatttgaggagtgctccaagttaagccatcccttagggagcacagaaca
ttatgtgatatatggttcaagtaatggtttagtttgcatgtcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaacttaggacgcctccaatcagcaccaacattaaccttaaattttcccacatctctctccaa
ttcgggttccaccctggggttaatgactacaaggcagtaaggatgatgcgtaccaacaaaactgccgtggcagttgaggt
gtatagtctcagaacagacagttggaagatgattgaggcaattcctccttggttaaaatgcacttggctgcattataagg
gtacatttttgaatggagtagcataccacatcattgagaaaggtcctatattcagcattatgtcattcgattcaggcact
gaagaattcgaagaagtcatagcaccagatgccatttgcagttcatgggggttatgtattggcgtttataaggaacaaat
ttgcttgctttctggattttatggttgtgaggatgagggtatggacaaaattgacttatgggttctgcaagcaaaacgat
ggaaacaattgtgttctgttgtttttcctttgggtgattgtgagcgtataatcgggattagtaaaggtactgaactctta
atggaaaaaaaagatttcaataagggcgtaggagagctgtatttgtgtaattacgaatccaagcagtttctggaaacagg
aattaggttggccgtcgtgaaatatgacgaaatcgaattcttgtttgtaattacctacatagagagcttggttttactca
at
back to top
>DQ993667.1-SFB1.m11122
atgacattcacactacgcaagaaagaaatcttaatcgacatcctattaagactacctgcaaaatcccttgttcggtttct
gtgtacacgcaagtcttggaatgatctgattggcagctcaagttttgttagcacacacctcaacaggaatgtcacaaatc
atgcccatgtttatctactctgcctccaccacccaaatgttagacgccagttcaaccccgatgacccatatgttaaacaa
gaatgccaatggtctattttttcgaatgaaacatttgaggagtgctccaagttaagccatcccttagggagcacagaaca
ttatgtgatatatggttcaagtaatggtttagtttgcatgtcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaggaaacttaggacgcctccaatcagcaccaacattaaccttaaattttcccacatctctctccaa
ttcgggttccaccctggggttaatgactacaaggcagtaaggatgatgcgtaccaacaaaactgccgtggcagttgaggt
gtatagtctcagaacagacagttggaagatgattgaggcaattcctccttggttaaaatgcacttggctgcattataagg
gtacatttttgaatggagtagcataccacatcattgagaaaggtcctatattcagcattatgtcattcgattcaggcact
gaagaattcgaagaagtcatagcaccagatgccatttgcagttcatgggggttatgtattggcgtttataaggaacaaat
ttgcttgctttctggattttatggttgtgaggatgagggtatggacaaaattgacttatgggttctgcaagcaaaacgat
ggaaacaattgtgttctgttgtttttcctttgggtgattgtgagcgtataatcgggattagtaaaggtactgaactctta
atggaaaaaaaagatttcaataagggcgtaggagagctgtatttgtgtaattacgaatccaagcagtttctggaaacagg
aattaggttggccgtcgtgaaatatgacgaaatcgaattcttgtttgtaattacctacatagagagcttggttttactca
at
back to top