SFB22, SFB22 (gene) Prunus mume

Gene Overview
Name SFB22
Gene Symbol SFB22
Type gene
Organism Prunus mume
Synonym SFB22
Description NA
Comment PmSFB22
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB22JQ356584.1-SFB22Prunus mumegene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB22JQ356584.1-SFB22.m1Prunus mumemRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus mumegene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database JQ356584.1-SFB22 N/A JQ356584.1
mRNA parsed from NCBI nr database JQ356584.1-SFB22.m1 N/A JQ356584.1

Sequence(s):
>JQ356584.1-SFB22963
gttcggtttctttttacgtgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttaataggaa
tgtcacaaaacatgcccatgtctatctcctttgcctccaccacccaaattttgaatgcgtggtcgaccgtgatgacccat
atttagaagaagaagttcaatggtctcttttttccaaagaaacatttgagcagtgttccaagttaagccatcctttaggg
agcacggaacattatgtgatatatggtccaagcaatggtttagtttgcatttcagatgagatattgaatttcgatagtcc
tatacacatatggaacccatcggttaggaaacttaggacgcttccaatgagcaccaacattaacattaaatttagctctg
tttctctccaattcgggatccaccccggggttaatgattacaaggctgtgaggatgatgcgtaccaacaaaggtgctttg
gcagttgaggtttatagtcttagaacagaatcttggaagatgactgaaacaattccttcttggttaaaatgcacttggca
gcatcagacgggtacgttttttaatggagtggcatacaacatcattgagaaaggtcctatagtcagcattatgtcattcg
attcagacagtgaagtattcgaagaattcatagcaccagatgccatttgccgtccatttgcgttaagtattgacgtttac
aaggaacaaatttgcttgctttttagattttattactgtgaggaggatatgggaaaaaatgacttatgggttctgcaaga
cagacggtggaaacagttgtgtccttttatttatcctgttggtacgtatagtacaatcgggattagtatagataatgaac
tcttaatggaaagaagagatttccgtaggggcgtaggagatctgtgtttatgtaattacgaatccaagcaagttcttgaa
aca
back to top
>JQ356584.1-SFB22.m1963
gttcggtttctttttacgtgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttaataggaa
tgtcacaaaacatgcccatgtctatctcctttgcctccaccacccaaattttgaatgcgtggtcgaccgtgatgacccat
atttagaagaagaagttcaatggtctcttttttccaaagaaacatttgagcagtgttccaagttaagccatcctttaggg
agcacggaacattatgtgatatatggtccaagcaatggtttagtttgcatttcagatgagatattgaatttcgatagtcc
tatacacatatggaacccatcggttaggaaacttaggacgcttccaatgagcaccaacattaacattaaatttagctctg
tttctctccaattcgggatccaccccggggttaatgattacaaggctgtgaggatgatgcgtaccaacaaaggtgctttg
gcagttgaggtttatagtcttagaacagaatcttggaagatgactgaaacaattccttcttggttaaaatgcacttggca
gcatcagacgggtacgttttttaatggagtggcatacaacatcattgagaaaggtcctatagtcagcattatgtcattcg
attcagacagtgaagtattcgaagaattcatagcaccagatgccatttgccgtccatttgcgttaagtattgacgtttac
aaggaacaaatttgcttgctttttagattttattactgtgaggaggatatgggaaaaaatgacttatgggttctgcaaga
cagacggtggaaacagttgtgtccttttatttatcctgttggtacgtatagtacaatcgggattagtatagataatgaac
tcttaatggaaagaagagatttccgtaggggcgtaggagatctgtgtttatgtaattacgaatccaagcaagttcttgaa
aca
back to top