SFB27, SFB27 (gene) Prunus armeniaca

Gene Overview
Name SFB27
Gene Symbol SFB27
Type gene
Organism Prunus armeniaca
Synonym S-locus F-box protein 27
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB27FJ377728.1-SFB27Prunus armeniacagene
SFB27EU836687.1-SFB27Prunus armeniacagene
SFB27FJ377731.1-SFB27Prunus armeniacagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB27FJ377728.1-SFB27.m1Prunus armeniacamRNA
SFB27EU836687.1-SFB27.m1Prunus armeniacamRNA
SFB27FJ377731.1-SFB27.m1Prunus armeniacamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus armeniacagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database FJ377728.1-SFB27 scaffold_6:26422391..26422839
FJ377728.1
gene parsed from NCBI nr database EU836687.1-SFB27 N/A EU836687.1
gene parsed from NCBI nr database FJ377731.1-SFB27 N/A FJ377731.1
mRNA parsed from NCBI nr database FJ377728.1-SFB27.m1 scaffold_6:26422391..26422839
FJ377728.1
mRNA parsed from NCBI nr database EU836687.1-SFB27.m1 N/A EU836687.1
mRNA parsed from NCBI nr database FJ377731.1-SFB27.m1 N/A FJ377731.1

Sequence(s):
>FJ377728.1-SFB27449
atgacattcacactaagtaagaaagaaaacttaatcgacatcctggtaagattacctgcaaaatccctcgttcggtttct
gtgtacatccaagtcatggagtgatttgattggcggctcgagttttgttagcgcacaccttaataggaatgccacaaaac
atgcccatgtctgtctactttgtctccaccacccaaattttgaacgcctggtcaaccgtgatgacccatattttaaaaaa
gaatttcaatggtctcttttttccaatgaaacatttgaggagttctccaagttaagccatcccgtagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatatccgatgagatactgaatttcgatagtcctatatacatat
ggaacccatcagttaggaaacttaggaccacttcaatgagcaccaacaa
back to top
>EU836687.1-SFB271059
gaaatcttaatcgacatcctcgtaagactacctgcaaaatcccttgttcggtttctgtgtacatgcaagtcgtggagtga
tttgattggcagctcgggttttgttagtacacaccttcataggaatgtcacaaaacatgcccatgtctatctactttgcc
tccaccacccaaactttgaacgtcagaacgacaatgatgacccatatgatatagaagaacttcaatggtcacttttttcc
aatggaacatttgtgcagttctccaatttaagccatccttcagaaaacacagagcattataggatatatggttcaagcaa
tggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatatggaacccatcggtcaggaaattta
ggaccactccaacgagcaccaacattaacattaaatttagctatgttgctctccaatttggattccaccccggggttgat
gactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagtctcagaacagactcttg
gaagatgattgaagcaattcctccttggttaaaatgcacttggaaaaatcataaggatacattttttaatggagtagcat
atcacataattgagaaaggtcccatcttcagcattatgtcctttgattcaggcagtgaagaattcgaagaattcatagca
ccagatgccatttgcggtccatggggtttatgtatcgacatttacaagggacaaatttgcttgctttgtagatattatgg
ttgtgaggaggatggcatggaaaaagtcgacttatgggttctgcaagaaaaacggtggaagcaattgtgtccttttattt
ttccttgggatgaatggaacgttacaatcgggattagcatagatgatgaactgttaatggaaataagagatttcgataag
ggcgtagcagatctgtatttgtgtaattacgaatccaaggaagttcttaaaacaggaattaagttggccgtcatgaaata
tggcgaaatcgaattcgtg
back to top
>FJ377731.1-SFB27451
atgacattcgcactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcgatttct
gtgtacatgcaagtcatggagtgatttgattggcagctcgagttttgttagcacacaccttcataggaatgtcacaggac
atgcccatgcctatctcctttgcctccaccacccaaattttgaatgtcaaagggacgatgatgaccgttattttaaagaa
gaactccaatggtcactgttttccaatgtaacatttgaagagagctccaagttaagccatcccttagggagcacagaaca
ttatgtgatatatggttcaagcaatggtttagtttgcatatcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaacttagaaccacttcaatgagcaccaacaagg
back to top
>FJ377728.1-SFB27.m1449
atgacattcacactaagtaagaaagaaaacttaatcgacatcctggtaagattacctgcaaaatccctcgttcggtttct
gtgtacatccaagtcatggagtgatttgattggcggctcgagttttgttagcgcacaccttaataggaatgccacaaaac
atgcccatgtctgtctactttgtctccaccacccaaattttgaacgcctggtcaaccgtgatgacccatattttaaaaaa
gaatttcaatggtctcttttttccaatgaaacatttgaggagttctccaagttaagccatcccgtagggagcacagaaca
ttatgtgatatatggctcaagcaatggtttagtttgcatatccgatgagatactgaatttcgatagtcctatatacatat
ggaacccatcagttaggaaacttaggaccacttcaatgagcaccaacaa
back to top
>EU836687.1-SFB27.m11059
gaaatcttaatcgacatcctcgtaagactacctgcaaaatcccttgttcggtttctgtgtacatgcaagtcgtggagtga
tttgattggcagctcgggttttgttagtacacaccttcataggaatgtcacaaaacatgcccatgtctatctactttgcc
tccaccacccaaactttgaacgtcagaacgacaatgatgacccatatgatatagaagaacttcaatggtcacttttttcc
aatggaacatttgtgcagttctccaatttaagccatccttcagaaaacacagagcattataggatatatggttcaagcaa
tggtttagtttgcatttcggatgagatattgaatttcgatagtcctatacacatatggaacccatcggtcaggaaattta
ggaccactccaacgagcaccaacattaacattaaatttagctatgttgctctccaatttggattccaccccggggttgat
gactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttggcggttgaggtttatagtctcagaacagactcttg
gaagatgattgaagcaattcctccttggttaaaatgcacttggaaaaatcataaggatacattttttaatggagtagcat
atcacataattgagaaaggtcccatcttcagcattatgtcctttgattcaggcagtgaagaattcgaagaattcatagca
ccagatgccatttgcggtccatggggtttatgtatcgacatttacaagggacaaatttgcttgctttgtagatattatgg
ttgtgaggaggatggcatggaaaaagtcgacttatgggttctgcaagaaaaacggtggaagcaattgtgtccttttattt
ttccttgggatgaatggaacgttacaatcgggattagcatagatgatgaactgttaatggaaataagagatttcgataag
ggcgtagcagatctgtatttgtgtaattacgaatccaaggaagttcttaaaacaggaattaagttggccgtcatgaaata
tggcgaaatcgaattcgtg
back to top
>FJ377731.1-SFB27.m1451
atgacattcgcactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccctcgttcgatttct
gtgtacatgcaagtcatggagtgatttgattggcagctcgagttttgttagcacacaccttcataggaatgtcacaggac
atgcccatgcctatctcctttgcctccaccacccaaattttgaatgtcaaagggacgatgatgaccgttattttaaagaa
gaactccaatggtcactgttttccaatgtaacatttgaagagagctccaagttaagccatcccttagggagcacagaaca
ttatgtgatatatggttcaagcaatggtttagtttgcatatcggatgagatattgaatttcgatagtcctatacacatat
ggaacccatcggttaagaaacttagaaccacttcaatgagcaccaacaagg
back to top