SFB2, SFB2 (gene) Prunus mume

Gene Overview
Name SFB2
Gene Symbol SFB2
Type gene
Organism Prunus mume
Synonym SFB2
S locus F-box protein with the low allelic sequence polymorphism 2-Sf
SLFL2
Description NA
Comment PmSFB2
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB2JQ356589.1-SFB2Prunus mumegene
SFB2AB280957.1-SFB2Prunus mumegene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB2JQ356589.1-SFB2.m1Prunus mumemRNA
SFB2AB280957.1-SFB2.m1Prunus mumemRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus mumegene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database JQ356589.1-SFB2 N/A JQ356589.1
gene parsed from NCBI nr database AB280957.1-SFB2 N/A AB280957.1
mRNA parsed from NCBI nr database JQ356589.1-SFB2.m1 N/A JQ356589.1
mRNA parsed from NCBI nr database AB280957.1-SFB2.m1 N/A AB280957.1

Sequence(s):
>JQ356589.1-SFB2972
attcgatttctgtttacgtgcaagtcatggagtgatttgatcagcagctcgagttttgtcagcacacaccttgataggaa
tgtcattaaacatgcccatgtctatttactttgcctcctccacccaaatgttgaacgtcaggctgaccctaatgacccct
atgttaaacaagaatttcaatggtcattgttttccaatgaaacatttgaggagtgctccaagttaagccatcccttgagg
agcacagaatattatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcc
tatacacatatggaacccatcagttaagaaatttaggacctctccaatgagccccaacattaacattaaatatagctatg
ttgctctccaattcgggttccaccctagggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttg
gcggttgaggtttatagtctcacaacagactcttggaagatgattgaagcaattcctccttggttaagatgcacttggca
gcatctgaatggtacaatttttaatggagttgcataccacatcattcagaaaggttctatattcagcgttatgtcatttg
attcaggcagtgaagaattcgaagaattcatagcgccagatgccatttgcagttcattggggttatgcatccgggtttac
aaggaacaaatctgcttgctttttggattttatggttgtgaggaggaggatatggacaaaattgacttctgggttctgca
agaaaaaaggtggacacaattgtgtccttttatttattatcctttggattattctcatcgtataatcgggattagtatag
ataatgaactcttaatggaaagaagacttttccttaggggcataggatatctgcatttgtgtaattacgaatccaagcaa
gttcttgaaaca
back to top
>AB280957.1-SFB21290
atgatgagagaaatggcaacgttgagcaaattttctgaagatatgatggggaatatcctgtcgagactgcctcccaagtc
tctgatgcgatttagatgcgtcctcaagtcgtggcatgatctaatcgataaacctagcttcgtggaccaccacctttcca
tttctatggacaacaaagtcacctcctccacttacgtcctcctcaagcacaatgtcctcacggaccccagcattaaggac
gacgagaaggcagttagagctactctcttcaaccccgacagtaaccaaagggacattttactctcctcacttaatctcgg
cagccttgtcgacgacggtcttgagattgagaaccatgtcgttccgcagcctatgagaggatacgcattgagcctagaaa
tttcaggctcttgtgatggcctcatctgcctcaatacttttaacagcgaggacattgttttatgcaatccagcactcgag
gaatatagagttcttcccaagtcttgtattcttttgcctccgcgagttccacgtcaatttgaagaaaatgaagacgatga
ttattatgaagaagacgaagacgatgagatagaatcgaacccaaaatgtgtggggttcgggtacgatccgaactcgaaag
actacaaagttgttcgagctgcacaatttgtctctggggtttttacccagcacccctccaaagtagaggtttacagcttg
gctgccgatacttggagagaggtccctgttgacatccagcctcatggctctctaaacccgtcttaccagatgtacttcaa
gggattcttttactggatcgcgtactggacggaagaaagaaatgtcatcctttcgtttgacatgagcgaggaggtgtttc
atgacatagctcttccggagagtggcccagatgcatatgaatacacaagcattgcagtgtggaaagactctctggttctc
ttgacctacccggtggaaaacgaagctcctaaaaccttagacttgtgggtcttggatgaagacttgaaaggtgctactaa
gggtttgtggaaaaagcacttggctataggacctctggaaaaaggggttgaggctccattggtgttttggaaagatgagg
agcttcttatggttacgactaatggggatgtggtaaactatagccttgatacacaaaagctcaagcatgtcccccgccat
ggattgggagagccaaccaatatccaagcggttccttacgtgaatagtattgtttcaattaagccaggcaacaagattga
aagcatatag
back to top
>JQ356589.1-SFB2.m1972
attcgatttctgtttacgtgcaagtcatggagtgatttgatcagcagctcgagttttgtcagcacacaccttgataggaa
tgtcattaaacatgcccatgtctatttactttgcctcctccacccaaatgttgaacgtcaggctgaccctaatgacccct
atgttaaacaagaatttcaatggtcattgttttccaatgaaacatttgaggagtgctccaagttaagccatcccttgagg
agcacagaatattatgggatatatggttcaagcaatggtttagtttgcatttcggatgagatattgaatttcgatagtcc
tatacacatatggaacccatcagttaagaaatttaggacctctccaatgagccccaacattaacattaaatatagctatg
ttgctctccaattcgggttccaccctagggttaatgactacaaggctgtaaggatgatgcgtaccaacaaaaatgccttg
gcggttgaggtttatagtctcacaacagactcttggaagatgattgaagcaattcctccttggttaagatgcacttggca
gcatctgaatggtacaatttttaatggagttgcataccacatcattcagaaaggttctatattcagcgttatgtcatttg
attcaggcagtgaagaattcgaagaattcatagcgccagatgccatttgcagttcattggggttatgcatccgggtttac
aaggaacaaatctgcttgctttttggattttatggttgtgaggaggaggatatggacaaaattgacttctgggttctgca
agaaaaaaggtggacacaattgtgtccttttatttattatcctttggattattctcatcgtataatcgggattagtatag
ataatgaactcttaatggaaagaagacttttccttaggggcataggatatctgcatttgtgtaattacgaatccaagcaa
gttcttgaaaca
back to top
>AB280957.1-SFB2.m11290
atgatgagagaaatggcaacgttgagcaaattttctgaagatatgatggggaatatcctgtcgagactgcctcccaagtc
tctgatgcgatttagatgcgtcctcaagtcgtggcatgatctaatcgataaacctagcttcgtggaccaccacctttcca
tttctatggacaacaaagtcacctcctccacttacgtcctcctcaagcacaatgtcctcacggaccccagcattaaggac
gacgagaaggcagttagagctactctcttcaaccccgacagtaaccaaagggacattttactctcctcacttaatctcgg
cagccttgtcgacgacggtcttgagattgagaaccatgtcgttccgcagcctatgagaggatacgcattgagcctagaaa
tttcaggctcttgtgatggcctcatctgcctcaatacttttaacagcgaggacattgttttatgcaatccagcactcgag
gaatatagagttcttcccaagtcttgtattcttttgcctccgcgagttccacgtcaatttgaagaaaatgaagacgatga
ttattatgaagaagacgaagacgatgagatagaatcgaacccaaaatgtgtggggttcgggtacgatccgaactcgaaag
actacaaagttgttcgagctgcacaatttgtctctggggtttttacccagcacccctccaaagtagaggtttacagcttg
gctgccgatacttggagagaggtccctgttgacatccagcctcatggctctctaaacccgtcttaccagatgtacttcaa
gggattcttttactggatcgcgtactggacggaagaaagaaatgtcatcctttcgtttgacatgagcgaggaggtgtttc
atgacatagctcttccggagagtggcccagatgcatatgaatacacaagcattgcagtgtggaaagactctctggttctc
ttgacctacccggtggaaaacgaagctcctaaaaccttagacttgtgggtcttggatgaagacttgaaaggtgctactaa
gggtttgtggaaaaagcacttggctataggacctctggaaaaaggggttgaggctccattggtgttttggaaagatgagg
agcttcttatggttacgactaatggggatgtggtaaactatagccttgatacacaaaagctcaagcatgtcccccgccat
ggattgggagagccaaccaatatccaagcggttccttacgtgaatagtattgtttcaattaagccaggcaacaagattga
aagcatatag
back to top