SFB3, SFB3 (gene) Prunus mume

Gene Overview
Name SFB3
Gene Symbol SFB3
Type gene
Organism Prunus mume
Synonym S haplotype-specific F-box protein 3
S locus F-box protein with the low allelic sequence polymorphism 3-Sf
SLFL3
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB3AB376968.1-SFB3Prunus mumegene
SFB3AB280958.1-SFB3Prunus mumegene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB3AB376968.1-SFB3.m1Prunus mumemRNA
SFB3AB280958.1-SFB3.m1Prunus mumemRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus mumegene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB376968.1-SFB3 N/A AB376968.1
gene parsed from NCBI nr database AB280958.1-SFB3 N/A AB280958.1
mRNA parsed from NCBI nr database AB376968.1-SFB3.m1 N/A AB376968.1
mRNA parsed from NCBI nr database AB280958.1-SFB3.m1 N/A AB280958.1

Sequence(s):
>AB376968.1-SFB31140
atgacattcagacgagggaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccatcgttcggtttac
ttgtacatgcaagtcatggagcgatttgattggcagctcgagttttgtcagcacacatcttcgtaggaatgtcacaaaac
atgcccatgtctatctactctgcctccaccaccaaagttttgaatgtcaggtcgaccttgatgacccatatgttggacaa
gaacttcaatggtctcttttttgcaatgaaacatttgagctgtgctccaagttaagccatcccttagggagcacagaaca
ttatatgatatatggttcaagcaatggtttagtttgcatttcggatgagatactgaattttgatagtcctatacacatat
ggaacccatcaatcaggaaacttaggacccctccactgagcgcaaacattaacattaaatttagccatgttgctctccag
ttcgggttccatcccggggttaatgactataaggcagtaaggatgatgcgtaccaacaaaaaagccttggcggttgaggt
ttatagtcttagaacagattcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacattttttaatggagtagcataccacatcattgaaaaaggtcctatattcagtattatgtctttcgattcaggcagt
gaagaattcgaagaattcatagcaccagatgccatttgcaattcatgggggttatgtattgacgtttacaaggaatacat
ttgcttgctttttagcttttattctcctcaggaggatggcatgggaaaaaaggacttatgggttctgcaggaaaaacggt
ggaaacaattgtctccttttatgtatcctttcgattgttgtagtacaatcgggattcgtattgataatgaactcttaatg
gaaataagagatttctctaggggcgtaggacatctgcatttgtgtaattatgaatccaagcaagttcttgaaacaggaat
tgagttagccgtcgtgaaatatggcgaaatcgaattcttgtttgcacttacttacatagaaagtttgctgttactcaata
attatatagcagatgtataa
back to top
>AB280958.1-SFB31224
atgacatacttttacaaaatgacagaagaaatggaggtgcaaatcctagcaaggctgcctcccaaatccctaatgcgatt
caaatgtgtgtgtaaatcatggcatgctctcctcaataacccccattttgtagccaagcaccttcacttgtacaacaacc
aaccttcctccacttgcgtcctcttcaagcgttctgtcctcagcaggacagagcacaacaaggaggagcttgtattcaca
ttccttattcttcgcaacgacaacgaaagcaatgctgatcataaccttatcaattgtaacgttgaggacctccatttccc
acgttctatgggtttaaaaagtaggggccaattcattgagctccctggtttggagcttggtgaatctgtccacattgtag
gtcattgtgatgggttgttttgtttgtctctttacactggagaacttgttttctataatccagctatcaaggagtttagg
gttcttccccaatcatgccttgaagatgcctgctcatgcactttggggtttggctatgatcccaaacgtaaagattacgt
acttctcagcattgtgtcttatggggaggaaatatttgatgacgaacgtcttgtcatccatcctccccaagcagaaatat
acacattgagcactaattcttggagggagattgagactcattacttggaaacagaaacgacctacttttggggcaatgag
actttctcggcctatttcaatggagtgttttattggttggggtatgaggagaaaaaggagtttgtgtctttctatgacag
gcttgaggaggaaaagaagcaagtgatcattttgtttgacacatttgatgaagtttttcacaatatgccacttccggatt
gtttctatgagtttccatctcatgaaatgtcccttacggtgtggaacgaatccattgctcttttcgggttttatcgttgt
gaatttgaaccctttgaggtttgggtgatggatgagtttgatgggtggacaaaacacttatctgttgtgcccaaagtgga
tcaggaggtagatataccattggcaatttggaggaggaacgaggttcttttggttgacagagatggacgcatattcagct
acaacttcgataccgaaaatctgaagtatctccctgttcatggtgcgtccagaggagattttcaggctgttgtttgtgtt
aatagtatagtttcagtcaaatga
back to top
>AB376968.1-SFB3.m11140
atgacattcagacgagggaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaatccatcgttcggtttac
ttgtacatgcaagtcatggagcgatttgattggcagctcgagttttgtcagcacacatcttcgtaggaatgtcacaaaac
atgcccatgtctatctactctgcctccaccaccaaagttttgaatgtcaggtcgaccttgatgacccatatgttggacaa
gaacttcaatggtctcttttttgcaatgaaacatttgagctgtgctccaagttaagccatcccttagggagcacagaaca
ttatatgatatatggttcaagcaatggtttagtttgcatttcggatgagatactgaattttgatagtcctatacacatat
ggaacccatcaatcaggaaacttaggacccctccactgagcgcaaacattaacattaaatttagccatgttgctctccag
ttcgggttccatcccggggttaatgactataaggcagtaaggatgatgcgtaccaacaaaaaagccttggcggttgaggt
ttatagtcttagaacagattcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacattttttaatggagtagcataccacatcattgaaaaaggtcctatattcagtattatgtctttcgattcaggcagt
gaagaattcgaagaattcatagcaccagatgccatttgcaattcatgggggttatgtattgacgtttacaaggaatacat
ttgcttgctttttagcttttattctcctcaggaggatggcatgggaaaaaaggacttatgggttctgcaggaaaaacggt
ggaaacaattgtctccttttatgtatcctttcgattgttgtagtacaatcgggattcgtattgataatgaactcttaatg
gaaataagagatttctctaggggcgtaggacatctgcatttgtgtaattatgaatccaagcaagttcttgaaacaggaat
tgagttagccgtcgtgaaatatggcgaaatcgaattcttgtttgcacttacttacatagaaagtttgctgttactcaata
attatatagcagatgtataa
back to top
>AB280958.1-SFB3.m11224
atgacatacttttacaaaatgacagaagaaatggaggtgcaaatcctagcaaggctgcctcccaaatccctaatgcgatt
caaatgtgtgtgtaaatcatggcatgctctcctcaataacccccattttgtagccaagcaccttcacttgtacaacaacc
aaccttcctccacttgcgtcctcttcaagcgttctgtcctcagcaggacagagcacaacaaggaggagcttgtattcaca
ttccttattcttcgcaacgacaacgaaagcaatgctgatcataaccttatcaattgtaacgttgaggacctccatttccc
acgttctatgggtttaaaaagtaggggccaattcattgagctccctggtttggagcttggtgaatctgtccacattgtag
gtcattgtgatgggttgttttgtttgtctctttacactggagaacttgttttctataatccagctatcaaggagtttagg
gttcttccccaatcatgccttgaagatgcctgctcatgcactttggggtttggctatgatcccaaacgtaaagattacgt
acttctcagcattgtgtcttatggggaggaaatatttgatgacgaacgtcttgtcatccatcctccccaagcagaaatat
acacattgagcactaattcttggagggagattgagactcattacttggaaacagaaacgacctacttttggggcaatgag
actttctcggcctatttcaatggagtgttttattggttggggtatgaggagaaaaaggagtttgtgtctttctatgacag
gcttgaggaggaaaagaagcaagtgatcattttgtttgacacatttgatgaagtttttcacaatatgccacttccggatt
gtttctatgagtttccatctcatgaaatgtcccttacggtgtggaacgaatccattgctcttttcgggttttatcgttgt
gaatttgaaccctttgaggtttgggtgatggatgagtttgatgggtggacaaaacacttatctgttgtgcccaaagtgga
tcaggaggtagatataccattggcaatttggaggaggaacgaggttcttttggttgacagagatggacgcatattcagct
acaacttcgataccgaaaatctgaagtatctccctgttcatggtgcgtccagaggagattttcaggctgttgtttgtgtt
aatagtatagtttcagtcaaatga
back to top