SFB46, SFB46 (gene) Prunus armeniaca

Gene Overview
Name SFB46
Gene Symbol SFB46
Type gene
Organism Prunus armeniaca
Synonym S-locus F-box protein 46
Description NA
Comment GSI
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB46HQ148070.1-SFB46.m1Prunus armeniacamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus armeniacagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HQ148070.1-SFB46.m1 scaffold_3:2482812..2483239
HQ148070.1

Sequence(s):
>HQ148070.1-SFB46.m1434
gagatttctactttgcctccaccacgaagattttgaacgtaaattcgatgttgacgacccttttgtgaaacaagaccttc
agtggtcacttttttccaatgaaacatttgagcagcgtttcaagttaaagcatcccttacggagcacagagcattttggg
atatacggttcaagcaacggggtactttgcatttcggatgaaatattgaaacccaagagccgtatacacatatggaaccc
aaccattggcaagtataggactgttccgttgagcatcaccgacgacacgaaatttggctacattgctctccaattcgggt
tccaccctggggttaatgactacaaggttgtgaggatgatgtgcatggacaacaaagcattcgctgtcgaggtttatagt
cttgccacaaactcttggaagatgattgaagcaa
back to top