SFB4, SFB4 (gene) Prunus avium

Gene Overview
Name SFB4
Gene Symbol SFB4
Type gene
Organism Prunus avium
Synonym SFB4
SFB4'
S haplotype-specific F-box protein 4
Description NA
Comment irradiation induced truncated isoform
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB4AY649872.1-SFB4.m1Prunus aviummRNA
SFB4AY649873.1-SFB4.m1Prunus aviummRNA
SFB4AB111521.1-SFB4.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus aviumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AY649872.1-SFB4.m1 N/A AY649872.1
mRNA parsed from NCBI nr database AY649873.1-SFB4.m1 N/A AY649873.1
mRNA parsed from NCBI nr database AB111521.1-SFB4.m1 N/A AB111521.1

Sequence(s):
>AY649872.1-SFB4.m11090
atgacattcacactacgtaagaaagaaatcttgatcgacatcctagcaagactaccagcaaaatccctcattcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcacaaagc
atgatcatgtctatctactttgcctccaccacccaaattttgaacgtttggtcgaccctgataacccatattttaaaaag
gaatttcaatggtctcttttttccaatgagacatttaagcagtgctacaagttaaatcatcccttaggcagcacagaaca
ttatgtgatatatggttcaagcaacggtttagtttgcatttctgatgagatattgaattttgatagtcctatacacatat
ggaacccatcggttaggaaatttaggacccctccaatgagcactagcattaacattaaatttaattatattgctctccag
tttgggttccaccccagggttaatgactacaaggctgtaaggatgatgcgtacgaacaaagatgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacgttttttaatggaatatcataccacatcattgagaaatgtcctatattcagcattatgtcattcgattcaggcagt
gaagaattcgaagagttcatagcaccagatgtcatttgcagttcatgggggttatttattgacctttacaaggaacaaat
ttgcttgctttctagcttttattcttgcgaggagaagggtatgcgaaaaattgacttctgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttatttatccttctcattattatggtacactcggtattagtaaagataacgaactcttaatg
gaaaagagagatttctctaggggcataggagatctgcatttgtgtaattacgaatccaagcaagttcttgaaacaggaat
tgacttggccaccatcaaatatggtgaaatcgaattcttgtttgcaatta
back to top
>AY649873.1-SFB4.m1954
atgacattcacactacgtaagaaagaaatcttgatcgacatcctagcaagactaccagcaaaatccctcattcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcacaaagc
atgatcatgtctatctactttgcctccaccacccaaattttgaacgtttggtcgaccctgataacccatattttaaaaag
gaatttcaatggtctcttttttccaatgagacatttaagcagtgctacaagttaaatcatcccttaggcagcacagaaca
ttatgtgatatatggttcaagcaacggtttagtttgcatttctgatgagatattgaattttgatagtcctatacacatat
ggaacccatcggttaggaaatttaggacccctccaatgagcactagcattaacattaaatttaattatattgctctccag
tttgggttccaccccagggttaatgactacaaggctgtaaggatgatgcgtacgaacaaagatgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacgttttttaatggaatatcataccacatcattgagaaatgtcctatattcagcattatgtcattcgattcaggcagt
gaagaattcgaagagttcatagcaccagatgtcatttgcagttcatgggggttatttattgacctttacaaggaacaaat
ttgcttgctttctagcttttattcttgcgaggagaagggtatgcgaaaaattgacttctgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttatccttctcattattatggtacactcggtattagtaaagataacgaactcttaa
back to top
>AB111521.1-SFB4.m11128
atgacattcacactacgtaagaaagaaatcttgatcgacatcctagcaagactaccagcaaaatccctcattcggtttct
ttgtacatgcaagtcatggagtgatttgattggcagctcgagttttgtcagcacacaccttcataggaatgtcacaaagc
atgatcatgtctatctactttgcctccaccacccaaattttgaacgtttggtcgaccctgataacccatattttaaaaag
gaatttcaatggtctcttttttccaatgagacatttaagcagtgctacaagttaaatcatcccttaggcagcacagaaca
ttatgtgatatatggttcaagcaacggtttagtttgcatttctgatgagatattgaattttgatagtcctatacacatat
ggaacccatcggttaggaaatttaggacccctccaatgagcactagcattaacattaaatttaattatattgctctccag
tttgggttccaccccagggttaatgactacaaggctgtaaggatgatgcgtacgaacaaagatgccttggcggttgaggt
ttatagtcttagaacagactcttggaagatgattgaagcaattcctccttggttaaaatgcacttggcagcatcataagg
gtacgttttttaatggaatatcataccacatcattgagaaatgtcctatattcagcattatgtcattcgattcaggcagt
gaagaattcgaagagttcatagcaccagatgtcatttgcagttcatgggggttatttattgacctttacaaggaacaaat
ttgcttgctttctagcttttattcttgcgaggagaagggtatgcgaaaaattgacttctgggttctgcaagaaaaacggt
ggaaacaattgtgtccttttatttatccttctcattattatggtacactcggtattagtaaagataacgaactcttaatg
gaaaagagagatttctctaggggcataggagatctgcatttgtgtaattacgaatccaagcaagttcttgaaacaggaat
tgacttggccaccatcaaatatggtgaaatcgaattcttgtttgcaattacttacatagaaagtttagttttactcaata
atacttaa
back to top