SFB4, SFB4 (gene) Prunus persica

Gene Overview
Name SFB4
Gene Symbol SFB4
Type gene
Organism Prunus persica
Synonym S-haplotype specific F-box protein 4
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB4AB537566.1-SFB4Prunus persicagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB4AB537566.1-SFB4.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus persicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB537566.1-SFB4 N/A AB537566.1
mRNA parsed from NCBI nr database AB537566.1-SFB4.m1 N/A AB537566.1

Sequence(s):
>AB537566.1-SFB4399
atgatattcacactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaagccctcgttcgatttct
gtgtacatgcaagtcatggagtgatttgattgggagctcgagttttgtgagcacacaccttcatagtaatgtcgcaaagc
atgaccatgtctatctactttgcctccactactcaaattttgaacttcaggctgatcctgatgacccatatgttaaacaa
gaatttcaatggtctcttttttccaatcaaacatttgaagagtgctccatgttaagccatcccttagggatcacagaaca
ttatgtgatgtacggctcaagcaatggtttaatttgcatttcggatgagatactgaatttcgatagtcctatatgttga
back to top
>AB537566.1-SFB4.m1399
atgatattcacactacgtaagaaagaaatcttaatcgacatcctagtaagactacctgcaaaagccctcgttcgatttct
gtgtacatgcaagtcatggagtgatttgattgggagctcgagttttgtgagcacacaccttcatagtaatgtcgcaaagc
atgaccatgtctatctactttgcctccactactcaaattttgaacttcaggctgatcctgatgacccatatgttaaacaa
gaatttcaatggtctcttttttccaatcaaacatttgaagagtgctccatgttaagccatcccttagggatcacagaaca
ttatgtgatgtacggctcaagcaatggtttaatttgcatttcggatgagatactgaatttcgatagtcctatatgttga
back to top