SFB4, SFB4 (gene) Prunus spinosa

Gene Overview
Name SFB4
Gene Symbol SFB4
Type gene
Organism Prunus spinosa
Synonym S locus F-box protein 4
SLFL1
SLFL4
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB4EU876741.1-SFB4Prunus spinosagene
SFB4EU876740.1-SFB4Prunus spinosagene
SFB4EU876739.1-SFB4Prunus spinosagene
SFB4EU876738.1-SFB4Prunus spinosagene
SFB4EU876737.1-SFB4Prunus spinosagene
SFB4EU876736.1-SFB4Prunus spinosagene
SFB4EU876735.1-SFB4Prunus spinosagene
SFB4EU876734.1-SFB4Prunus spinosagene
SFB4EU876733.1-SFB4Prunus spinosagene
SFB4EU876732.1-SFB4Prunus spinosagene
SFB4EU876731.1-SFB4Prunus spinosagene
SFB4EU876730.1-SFB4Prunus spinosagene
SFB4EU876742.1-SFB4Prunus spinosagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB4EU876741.1-SFB4.m1Prunus spinosamRNA
SFB4EU876740.1-SFB4.m1Prunus spinosamRNA
SFB4EU876739.1-SFB4.m1Prunus spinosamRNA
SFB4EU876738.1-SFB4.m1Prunus spinosamRNA
SFB4EU876737.1-SFB4.m1Prunus spinosamRNA
SFB4EU876736.1-SFB4.m1Prunus spinosamRNA
SFB4EU876735.1-SFB4.m1Prunus spinosamRNA
SFB4EU876734.1-SFB4.m1Prunus spinosamRNA
SFB4EU876733.1-SFB4.m1Prunus spinosamRNA
SFB4EU876732.1-SFB4.m1Prunus spinosamRNA
SFB4EU876731.1-SFB4.m1Prunus spinosamRNA
SFB4EU876730.1-SFB4.m1Prunus spinosamRNA
SFB4EU876742.1-SFB4.m1Prunus spinosamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus spinosagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU876741.1-SFB4 N/A EU876741.1
gene parsed from NCBI nr database EU876740.1-SFB4 N/A EU876740.1
gene parsed from NCBI nr database EU876739.1-SFB4 N/A EU876739.1
gene parsed from NCBI nr database EU876738.1-SFB4 N/A EU876738.1
gene parsed from NCBI nr database EU876737.1-SFB4 N/A EU876737.1
gene parsed from NCBI nr database EU876736.1-SFB4 N/A EU876736.1
gene parsed from NCBI nr database EU876735.1-SFB4 N/A EU876735.1
gene parsed from NCBI nr database EU876734.1-SFB4 N/A EU876734.1
gene parsed from NCBI nr database EU876733.1-SFB4 N/A EU876733.1
gene parsed from NCBI nr database EU876732.1-SFB4 N/A EU876732.1
gene parsed from NCBI nr database EU876731.1-SFB4 N/A EU876731.1
gene parsed from NCBI nr database EU876730.1-SFB4 N/A EU876730.1
gene parsed from NCBI nr database EU876742.1-SFB4 N/A EU876742.1
mRNA parsed from NCBI nr database EU876741.1-SFB4.m1 N/A EU876741.1
mRNA parsed from NCBI nr database EU876740.1-SFB4.m1 N/A EU876740.1
mRNA parsed from NCBI nr database EU876739.1-SFB4.m1 N/A EU876739.1
mRNA parsed from NCBI nr database EU876738.1-SFB4.m1 N/A EU876738.1
mRNA parsed from NCBI nr database EU876737.1-SFB4.m1 N/A EU876737.1
mRNA parsed from NCBI nr database EU876736.1-SFB4.m1 N/A EU876736.1
mRNA parsed from NCBI nr database EU876735.1-SFB4.m1 N/A EU876735.1
mRNA parsed from NCBI nr database EU876734.1-SFB4.m1 N/A EU876734.1
mRNA parsed from NCBI nr database EU876733.1-SFB4.m1 N/A EU876733.1
mRNA parsed from NCBI nr database EU876732.1-SFB4.m1 N/A EU876732.1
mRNA parsed from NCBI nr database EU876731.1-SFB4.m1 N/A EU876731.1
mRNA parsed from NCBI nr database EU876730.1-SFB4.m1 N/A EU876730.1
mRNA parsed from NCBI nr database EU876742.1-SFB4.m1 N/A EU876742.1

Sequence(s):
>EU876741.1-SFB4478
aggccattgtaatgggatagtttgtttatgtgactgcggtggcaacattattttatgcaatccagcaatcaaggaactca
aacttcttccgaaatcatgccttccaaattgggggtactctgatgtgggtattggatatgatcccaaatctaaagattac
aaagttcagagaatttcatgtgatggcgaggaaatttatggtgaccgtcttgtttttttccctcctagagttgaaatata
caatctcagtactgatacttggcgagagatcaaaagtaattgtttagaaacagaagctacattcttatggcccgaagatt
tcgagatgtactggaaaggaatatgttattggttggggtatgagcaaccgaaagaattcgagtcttactttgatagactt
gaggatgagaaaaagaagacagtggtctttttttttgacacgggggatgaggtatttcatagtatattacttccagat
back to top
>EU876740.1-SFB4478
aggccattgtgatgggatagtttgtttatgtgactgcggtggcaacattattttatgcaatccagcaatcaaggaactca
aacttcttccgaaatcatgccttccaaattgggggtactctgatgtgggtattggatatgatcccaaatctaaagattac
aaagttcagagaatttcatgtgatggcgaggaaatttatggtgaccgtcttgtttttttccctcctagagttgaaatata
caatctcagtactgatacttggcgagagatcaaaagtaattgtttagaaacagaagctacattcttatggcccgaagatt
tcgagatgtactggaaaggaatatgttattggttggggtatgagcaaccgaaagaattcgagtcttactttgatagactt
gaggatgagaaaaagaagacagtggtctttttttttgacacgggggatgaggtatttcatagtatattacttccagat
back to top
>EU876739.1-SFB4478
aggccattgtgatgggatagtttgtttatgtgactgcggtggcaacattattttatgcaatccagcaatcaaggaactca
aacttcttccgaaatcatgccttccaaattgggggtactctgatgtgggtattggatatgatccgaaatctaaagattac
aaagttcagagaatttcatgtgatggcgaggaaatttatggtgaccgtcttgtttttttccctcctagagttgaaatata
caatctcagtacagatacttggcgagagatcaaaagtaattgtttagaaacagaagctacattcttatggcccgaagatt
tcgagatgtactggaaaggaatatgttattggttggggtatgagcaaccgaaagaattcgagtcttactttgataaactt
gaggatgagaaaaagaagacagtggtctttttttttgacacgggggatgaggtatttcatagtatattacttccagat
back to top
>EU876738.1-SFB4478
aggccattgtgatgggatagtttgtttatgtgactgcggtggcaacattattttatgcaatccagcaatcaaggaactca
aacttcttccgaaatcatgccttccaaattgggggtactctgatgtgggtattggatatgatcccaaatctaaagattac
aaagttcagagaatttcatgtgatggcgaggaaatttatggtgaccgtcttgtttttttccctcctagagttgaaatata
caatctcagtactgatacttggcgagagatcaaaagtaattgtttagaaacagaagctacgttcttatggcccgaagatt
tcgagatgtactggaaaggaatatgttattggttagggtatgagcaaccgaaagaattcgagtcttactttgatagactt
gaggatgagaaaaagaagacagtggtcttttcttttgacacgggggatgaggtatttcatagtatattacttccagat
back to top
>EU876737.1-SFB4478
aggccattgtgatgggatagtttgtttatgtgactgcggtggcaacattattttatgcaatccagcaatcaaggaactca
aacttcttccgaaatcatgccttccaaattgggggtactctgatgtgggtattggatatgatcccaaatctaaagattac
aaagttcagagaatttcatgtgatggcgaggaaatttatggtgaccgtcttgtttttttccctcctagagttgaaatata
caatctcagtactgatacttggcgagagatcaaaagtaattgtttagaaacagaagctacattcttatggcccgaagatt
tcgagatgtactggaaaggaatatgttattggttggggtatgagcaaccgaaagaattcgagtcttactttgatagactt
gaggatgagaaaaagaagacagtggtctttttttttgacacgggggatgaggtatttcatagtatattacttccagat
back to top
>EU876736.1-SFB4478
aggccattgtgatgggatagtttgcttatgtgactgcggtggcaacattattttatgcaatccagcaatcaaggaactca
aacttcttccgaaatcatgccttccaaattgggggtactctgatgtgggtattggatatgatcccaaatctaaagattac
aaagttcagagaatttcatgtgatggtgaggaaatttatggtgaccgtcttgtttttttccctcctagagttgaaatata
caatctcagtactgatacttggcgagagatcaaaagtaattgtttagaaacagaagctacattcttatggcccgaagatt
tcgagatgtactggaaaggaatatgttattggttagggtatgagcaaccgaaagaattcgagtcttactttgatagactt
gaggatgagaaaaagaagacagtggtctttttttttgacacgggggatgaggtatttcatagtatattacttccagat
back to top
>EU876735.1-SFB4729
acaatttattgggctcaagcttgtagagtctttaagtattagaggccattgtgatgggatagtttgcttatgtgactgtg
gtggcaacattattttatgcaatccagcaatcaaggaactcaaacttcttccgaaatcatgccttccaaattgggggtac
tctgatgtgggtattggatatgatcccaaatctaaagattacaaagttcagagaatttcatgtgatggtgaggaaattta
tggtgaccgtcttgtttttttccgtcctagagttgaaatatacaatctcagtactgatacttggcgagagatcaaaagta
attgtttagaaacagaagctacgttcttatggcccgaagatttcgagatgtactggaaaggaatatgttattggttgggg
tatgagcaaccgaaagaattcgagtcttactttgatagacttgaggatgagaaaaagaagacagtggtctttttttttga
cacgggggatgaggtatttcatagtatattacttccagattgcgtatatgagccaccagaagaatatcgttatgatatga
gcattgtactgtggaatgaatccgtcgctctgttcggcttagagagtccagatgcatatgctgaatcctatggaatatgg
gtgatggacgactttgatggtggtaagggttcttggactagacacttaacttttaagctcttggtagacgttaaacgggt
attgagact
back to top
>EU876734.1-SFB4729
acaatttattgggctcaagcttgtagagtctgtaagtattagaggccattgtgatgggatagtttgtttatgtgactgcg
gtggcaacattattttatgcaatccagcaatcaaggaactcaaacttcttccgaaatcatgccttccaaattgggggtac
tctgatgtgggtattggatatgatcccaaatctaaagattacaaagttcagagaatttcatgtgatggcgaggaaattta
tggtgaccgtcttgtttttttccctcctagagttgaaatatacaatctcagtactgatacttggcgagagatcaaaagta
attgtttagaaacagaagctacattcttatggcccgaagatttcgagatgtactggaaaggaatatgttattggttgggg
tatgagcaaccgaaagaattcgagtcttactttgatagacttgaggatgagaaaaagaagacagtggtctttttttttga
cacgggggatgaggtatttcatagtatattacttccagattgcgtatatgagccaccagaagaatatcgttatgatatga
gcattgtactgtggaatgaatccgtcgctctgttcggcttagagagtccagatgcatatgctgaatcctatggaatatgg
gtgatggacgactttgatggtggtaagggttcttggactagacacttaacttttaagctcttggtagacgttaaacgggt
attgagact
back to top
>EU876733.1-SFB4729
acaatttattgggctcaagcttgtagagtctttaagtattagaggccattgtgatgggatagtttgcttatgtgactgtg
gtggcaacattattttatgcaatccagcaatcaaggaactcaaacttcttccgaaatcatgccttccaaattgggggtac
tctgatgtgggtattggatatgatcccaaatctaaagattacaaagttcagagaatttcatgtgatggtgaggaaattta
tggtgaccgtcttgtttttttccgtcctagagttgaaatatacaatctcagtactgatacttggcgagagatcaaaagta
attgtttagaaacagaagctacgttcttatggcccgaagatttcgagatgtactggaaaggaatatgttattggttgggg
tatgagcaaccgaaagaattcgagtcttactttgatagacttgaggatgagaaaaagaagacagtggtctttttttttga
cacgggggatgaggtatttcatagtatattacttccagattgcgtatatgagccaccagaagaatatcgttatgatatga
gcattgtactgtggaatgaatccgtcgctctgttcggcttagagagtccagatgcatatgctgaatcctatggaatatgg
gtgatggacgactttgatggtggtaagggttcttggactagacacttaacttttaagctcttggtagacgttaaacgggt
attgagact
back to top
>EU876732.1-SFB4729
acaatttatttggctcaagcttgtagagtctgtaagtattagaggccattgtgatgggatagtttgtttatgtgactgcg
gtggcaacattattttatgcaatccagcaatcaaggaactcaaacttcttccgaaatcatgccttccaaattgggggtac
tctgatgtgggtattggatatgatcccaaatctaaagattacaaagttcagagaatttcatgtgatggcgaggaaattta
tggtgaccgtcttgtttttttccctcctagagttgaaatatacaatctcagtactgatacttggcgagagatcaaaagta
attgtttagaaacagaagctacattcttatggcccgaagatttcgagatgtactggaaaggaatatgttattggttgggg
tatgagcaaccgaaagaattcgagtcttactttgatagacttgaggatgagaaaaagaagacagtggtctttttttttga
cacgggggatgaggtatttcatagtatattacttccagattgcgtatatgggccaccagaagaatattgttatgatatga
gcattgtactgtggaatgaatccgtcgctctattcggcttagagagtccagatgcatatgctgaaccctatggaatatgg
gtgatggacgactttgatggtggtaagggttcttggactagacacttaacttttaagctcttggtagacgttaaacgggt
attgagact
back to top
>EU876731.1-SFB4729
acaatttattgggctcaagcttgtagagtctgtaagtattagaggccattgtgatgggatagtttgtttatgtgactgcg
gtggcaacattattttatgcaatccagcaatcaaggaactcaaacttcttccgaaatcatgccttccaaattgggggtac
tctgatgtgggtattggatatgatcccaaatctaaagattacaaagttcagagaatttcatgtgatggcgaggaaattta
tggtgaccgtcttgtttttttccctcctagagttgaaatatacaatctcagtactgatacttggcgagagatcaaaagta
attgtttagaaacagaagctacattcttatggcccgaagatttcgagatgtactggaaaggaatatgttattggttgggg
tatgagcaaccgaaagaattcgagtcttactttgatagacttgaggatgagaaaaagaagacagtggtctttttttttga
cacgggggatgaggtatttcatagtatattacttccagattgcgtatatgagccaccagaagaatatcgttatgatatga
gcattgtactgtggaatgaatccgtcgctctgttcggcttagagagtccagatgcatatgctgaatcctatggaatatgg
gtgatggacgactttgatggtggtaagggttcttggactagacacttaacttttaagctcttggtagacgttaaacgggt
attgagact
back to top
>EU876730.1-SFB4729
acaatttattgggctcaagcttgtagagtctttaagtattagaggccattgtgatgggatagtttgcttatgtgactgtg
gtggcaacattattttatgcaatccagcaatcaaggaactcaaacttcttccgaaatcatgccttccaaattgggggtac
tctgatgtgggtattggatatgatcccaaatctaaagattacaaagttcagagaatttcatgtgatggtgaggaaattta
tggtgaccgtcttgtttttttccgtcctagagttgaaatatacaatctcagtactgatacttggcgagagatcaaaagta
attgtttagaaacagaagctacgttcttatggcccgaagatttcgagatgtactggaaaggaatatgttattggttgggg
tatgagcaaccgaaagaattcgagtcttactttgatagacttgaggatgagaaaaagaagacagtggtctttttttttga
cacgggggatgaggtatttcatagtatattacttccagattgcgtatatgagccaccagaagaatatcgttatgatatga
gcattgtactgtggaatgaatccgtcgctctgttcggcttagagagtccagatgcatatgctgaatcctatggaatatgg
gtgatggacgactttgatggtggtaagggttcttggactagacacttaacttttaagctcttggtagacgttaaacgggt
attgagact
back to top
>EU876742.1-SFB4478
aggccattgtgatgggatagtttgcttatgtgactgtggtggcaacattattttatgcaatccaacaatcaaggaactca
aacttcttccgaaatcatgccttccaaattggggttactctgatgtgggtattggatatgatcccaaatctaaagattac
aaagttcagagaatttcatgtgatggtgaggaaatttatggtgaccgtcttgtttttttccctcctagagttgaaatata
caatctcagtactgatacttggcgagagatcaaaagtaattgtttagaaacagaagctacattcttatggcccgaagatt
tcgagatgtactggaaaggaatatgttattggttggggtatgagcaaccgaaagaattcgagtcttactttgatagactt
gaggatgagaaaaagaagacagtggtctttttttttgacacgggggatgaggtatttcatagtatattacttccagat
back to top
>EU876741.1-SFB4.m1478
aggccattgtaatgggatagtttgtttatgtgactgcggtggcaacattattttatgcaatccagcaatcaaggaactca
aacttcttccgaaatcatgccttccaaattgggggtactctgatgtgggtattggatatgatcccaaatctaaagattac
aaagttcagagaatttcatgtgatggcgaggaaatttatggtgaccgtcttgtttttttccctcctagagttgaaatata
caatctcagtactgatacttggcgagagatcaaaagtaattgtttagaaacagaagctacattcttatggcccgaagatt
tcgagatgtactggaaaggaatatgttattggttggggtatgagcaaccgaaagaattcgagtcttactttgatagactt
gaggatgagaaaaagaagacagtggtctttttttttgacacgggggatgaggtatttcatagtatattacttccagat
back to top
>EU876740.1-SFB4.m1478
aggccattgtgatgggatagtttgtttatgtgactgcggtggcaacattattttatgcaatccagcaatcaaggaactca
aacttcttccgaaatcatgccttccaaattgggggtactctgatgtgggtattggatatgatcccaaatctaaagattac
aaagttcagagaatttcatgtgatggcgaggaaatttatggtgaccgtcttgtttttttccctcctagagttgaaatata
caatctcagtactgatacttggcgagagatcaaaagtaattgtttagaaacagaagctacattcttatggcccgaagatt
tcgagatgtactggaaaggaatatgttattggttggggtatgagcaaccgaaagaattcgagtcttactttgatagactt
gaggatgagaaaaagaagacagtggtctttttttttgacacgggggatgaggtatttcatagtatattacttccagat
back to top
>EU876739.1-SFB4.m1478
aggccattgtgatgggatagtttgtttatgtgactgcggtggcaacattattttatgcaatccagcaatcaaggaactca
aacttcttccgaaatcatgccttccaaattgggggtactctgatgtgggtattggatatgatccgaaatctaaagattac
aaagttcagagaatttcatgtgatggcgaggaaatttatggtgaccgtcttgtttttttccctcctagagttgaaatata
caatctcagtacagatacttggcgagagatcaaaagtaattgtttagaaacagaagctacattcttatggcccgaagatt
tcgagatgtactggaaaggaatatgttattggttggggtatgagcaaccgaaagaattcgagtcttactttgataaactt
gaggatgagaaaaagaagacagtggtctttttttttgacacgggggatgaggtatttcatagtatattacttccagat
back to top
>EU876738.1-SFB4.m1478
aggccattgtgatgggatagtttgtttatgtgactgcggtggcaacattattttatgcaatccagcaatcaaggaactca
aacttcttccgaaatcatgccttccaaattgggggtactctgatgtgggtattggatatgatcccaaatctaaagattac
aaagttcagagaatttcatgtgatggcgaggaaatttatggtgaccgtcttgtttttttccctcctagagttgaaatata
caatctcagtactgatacttggcgagagatcaaaagtaattgtttagaaacagaagctacgttcttatggcccgaagatt
tcgagatgtactggaaaggaatatgttattggttagggtatgagcaaccgaaagaattcgagtcttactttgatagactt
gaggatgagaaaaagaagacagtggtcttttcttttgacacgggggatgaggtatttcatagtatattacttccagat
back to top
>EU876737.1-SFB4.m1478
aggccattgtgatgggatagtttgtttatgtgactgcggtggcaacattattttatgcaatccagcaatcaaggaactca
aacttcttccgaaatcatgccttccaaattgggggtactctgatgtgggtattggatatgatcccaaatctaaagattac
aaagttcagagaatttcatgtgatggcgaggaaatttatggtgaccgtcttgtttttttccctcctagagttgaaatata
caatctcagtactgatacttggcgagagatcaaaagtaattgtttagaaacagaagctacattcttatggcccgaagatt
tcgagatgtactggaaaggaatatgttattggttggggtatgagcaaccgaaagaattcgagtcttactttgatagactt
gaggatgagaaaaagaagacagtggtctttttttttgacacgggggatgaggtatttcatagtatattacttccagat
back to top
>EU876736.1-SFB4.m1478
aggccattgtgatgggatagtttgcttatgtgactgcggtggcaacattattttatgcaatccagcaatcaaggaactca
aacttcttccgaaatcatgccttccaaattgggggtactctgatgtgggtattggatatgatcccaaatctaaagattac
aaagttcagagaatttcatgtgatggtgaggaaatttatggtgaccgtcttgtttttttccctcctagagttgaaatata
caatctcagtactgatacttggcgagagatcaaaagtaattgtttagaaacagaagctacattcttatggcccgaagatt
tcgagatgtactggaaaggaatatgttattggttagggtatgagcaaccgaaagaattcgagtcttactttgatagactt
gaggatgagaaaaagaagacagtggtctttttttttgacacgggggatgaggtatttcatagtatattacttccagat
back to top
>EU876735.1-SFB4.m1729
acaatttattgggctcaagcttgtagagtctttaagtattagaggccattgtgatgggatagtttgcttatgtgactgtg
gtggcaacattattttatgcaatccagcaatcaaggaactcaaacttcttccgaaatcatgccttccaaattgggggtac
tctgatgtgggtattggatatgatcccaaatctaaagattacaaagttcagagaatttcatgtgatggtgaggaaattta
tggtgaccgtcttgtttttttccgtcctagagttgaaatatacaatctcagtactgatacttggcgagagatcaaaagta
attgtttagaaacagaagctacgttcttatggcccgaagatttcgagatgtactggaaaggaatatgttattggttgggg
tatgagcaaccgaaagaattcgagtcttactttgatagacttgaggatgagaaaaagaagacagtggtctttttttttga
cacgggggatgaggtatttcatagtatattacttccagattgcgtatatgagccaccagaagaatatcgttatgatatga
gcattgtactgtggaatgaatccgtcgctctgttcggcttagagagtccagatgcatatgctgaatcctatggaatatgg
gtgatggacgactttgatggtggtaagggttcttggactagacacttaacttttaagctcttggtagacgttaaacgggt
attgagact
back to top
>EU876734.1-SFB4.m1729
acaatttattgggctcaagcttgtagagtctgtaagtattagaggccattgtgatgggatagtttgtttatgtgactgcg
gtggcaacattattttatgcaatccagcaatcaaggaactcaaacttcttccgaaatcatgccttccaaattgggggtac
tctgatgtgggtattggatatgatcccaaatctaaagattacaaagttcagagaatttcatgtgatggcgaggaaattta
tggtgaccgtcttgtttttttccctcctagagttgaaatatacaatctcagtactgatacttggcgagagatcaaaagta
attgtttagaaacagaagctacattcttatggcccgaagatttcgagatgtactggaaaggaatatgttattggttgggg
tatgagcaaccgaaagaattcgagtcttactttgatagacttgaggatgagaaaaagaagacagtggtctttttttttga
cacgggggatgaggtatttcatagtatattacttccagattgcgtatatgagccaccagaagaatatcgttatgatatga
gcattgtactgtggaatgaatccgtcgctctgttcggcttagagagtccagatgcatatgctgaatcctatggaatatgg
gtgatggacgactttgatggtggtaagggttcttggactagacacttaacttttaagctcttggtagacgttaaacgggt
attgagact
back to top
>EU876733.1-SFB4.m1729
acaatttattgggctcaagcttgtagagtctttaagtattagaggccattgtgatgggatagtttgcttatgtgactgtg
gtggcaacattattttatgcaatccagcaatcaaggaactcaaacttcttccgaaatcatgccttccaaattgggggtac
tctgatgtgggtattggatatgatcccaaatctaaagattacaaagttcagagaatttcatgtgatggtgaggaaattta
tggtgaccgtcttgtttttttccgtcctagagttgaaatatacaatctcagtactgatacttggcgagagatcaaaagta
attgtttagaaacagaagctacgttcttatggcccgaagatttcgagatgtactggaaaggaatatgttattggttgggg
tatgagcaaccgaaagaattcgagtcttactttgatagacttgaggatgagaaaaagaagacagtggtctttttttttga
cacgggggatgaggtatttcatagtatattacttccagattgcgtatatgagccaccagaagaatatcgttatgatatga
gcattgtactgtggaatgaatccgtcgctctgttcggcttagagagtccagatgcatatgctgaatcctatggaatatgg
gtgatggacgactttgatggtggtaagggttcttggactagacacttaacttttaagctcttggtagacgttaaacgggt
attgagact
back to top
>EU876732.1-SFB4.m1729
acaatttatttggctcaagcttgtagagtctgtaagtattagaggccattgtgatgggatagtttgtttatgtgactgcg
gtggcaacattattttatgcaatccagcaatcaaggaactcaaacttcttccgaaatcatgccttccaaattgggggtac
tctgatgtgggtattggatatgatcccaaatctaaagattacaaagttcagagaatttcatgtgatggcgaggaaattta
tggtgaccgtcttgtttttttccctcctagagttgaaatatacaatctcagtactgatacttggcgagagatcaaaagta
attgtttagaaacagaagctacattcttatggcccgaagatttcgagatgtactggaaaggaatatgttattggttgggg
tatgagcaaccgaaagaattcgagtcttactttgatagacttgaggatgagaaaaagaagacagtggtctttttttttga
cacgggggatgaggtatttcatagtatattacttccagattgcgtatatgggccaccagaagaatattgttatgatatga
gcattgtactgtggaatgaatccgtcgctctattcggcttagagagtccagatgcatatgctgaaccctatggaatatgg
gtgatggacgactttgatggtggtaagggttcttggactagacacttaacttttaagctcttggtagacgttaaacgggt
attgagact
back to top
>EU876731.1-SFB4.m1729
acaatttattgggctcaagcttgtagagtctgtaagtattagaggccattgtgatgggatagtttgtttatgtgactgcg
gtggcaacattattttatgcaatccagcaatcaaggaactcaaacttcttccgaaatcatgccttccaaattgggggtac
tctgatgtgggtattggatatgatcccaaatctaaagattacaaagttcagagaatttcatgtgatggcgaggaaattta
tggtgaccgtcttgtttttttccctcctagagttgaaatatacaatctcagtactgatacttggcgagagatcaaaagta
attgtttagaaacagaagctacattcttatggcccgaagatttcgagatgtactggaaaggaatatgttattggttgggg
tatgagcaaccgaaagaattcgagtcttactttgatagacttgaggatgagaaaaagaagacagtggtctttttttttga
cacgggggatgaggtatttcatagtatattacttccagattgcgtatatgagccaccagaagaatatcgttatgatatga
gcattgtactgtggaatgaatccgtcgctctgttcggcttagagagtccagatgcatatgctgaatcctatggaatatgg
gtgatggacgactttgatggtggtaagggttcttggactagacacttaacttttaagctcttggtagacgttaaacgggt
attgagact
back to top
>EU876730.1-SFB4.m1729
acaatttattgggctcaagcttgtagagtctttaagtattagaggccattgtgatgggatagtttgcttatgtgactgtg
gtggcaacattattttatgcaatccagcaatcaaggaactcaaacttcttccgaaatcatgccttccaaattgggggtac
tctgatgtgggtattggatatgatcccaaatctaaagattacaaagttcagagaatttcatgtgatggtgaggaaattta
tggtgaccgtcttgtttttttccgtcctagagttgaaatatacaatctcagtactgatacttggcgagagatcaaaagta
attgtttagaaacagaagctacgttcttatggcccgaagatttcgagatgtactggaaaggaatatgttattggttgggg
tatgagcaaccgaaagaattcgagtcttactttgatagacttgaggatgagaaaaagaagacagtggtctttttttttga
cacgggggatgaggtatttcatagtatattacttccagattgcgtatatgagccaccagaagaatatcgttatgatatga
gcattgtactgtggaatgaatccgtcgctctgttcggcttagagagtccagatgcatatgctgaatcctatggaatatgg
gtgatggacgactttgatggtggtaagggttcttggactagacacttaacttttaagctcttggtagacgttaaacgggt
attgagact
back to top
>EU876742.1-SFB4.m1478
aggccattgtgatgggatagtttgcttatgtgactgtggtggcaacattattttatgcaatccaacaatcaaggaactca
aacttcttccgaaatcatgccttccaaattggggttactctgatgtgggtattggatatgatcccaaatctaaagattac
aaagttcagagaatttcatgtgatggtgaggaaatttatggtgaccgtcttgtttttttccctcctagagttgaaatata
caatctcagtactgatacttggcgagagatcaaaagtaattgtttagaaacagaagctacattcttatggcccgaagatt
tcgagatgtactggaaaggaatatgttattggttggggtatgagcaaccgaaagaattcgagtcttactttgatagactt
gaggatgagaaaaagaagacagtggtctttttttttgacacgggggatgaggtatttcatagtatattacttccagat
back to top