SFB5, SFB5 (gene) Prunus spinosa

Gene Overview
Name SFB5
Gene Symbol SFB5
Type gene
Organism Prunus spinosa
Synonym S locus F-box protein 5
SLFL4
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB5EU876729.1-SFB5Prunus spinosagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB5EU876729.1-SFB5.m1Prunus spinosamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus spinosagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU876729.1-SFB5 N/A EU876729.1
mRNA parsed from NCBI nr database EU876729.1-SFB5.m1 N/A EU876729.1

Sequence(s):
>EU876729.1-SFB5714
acaattcagggttattaaatctctatgtattataggccattgtgatgggatagtttgtttatgtgatggtgacaacatag
ttttatgcaatccagcaataaaggaactcaagcttcttccagaatcatgctttccacagttgatccaatgtggtgtgggg
tttggatatgatcctaaatctaaatattacaaagttcatagaatttcatgtgatggtgaggaaatttatggtgaccgtct
tgttttctttcctcctagagttgaaatatacaccctcagtacagattcttggcgagagatcaataataactatttagaaa
cggaagatactttcttttggcctgattatttccagatgtactggaaaggaatttgttattgggttggatatgagcaacca
aaagaattcgagtcttactttgatagacttgaggatgagcaaaagaagacaatgatctttttgtttgacacaggtgatga
ggtatttcgtaatatattacttccagatagtttatatgagccaccagaatatcggtatatcatgcgcattctagtgtgga
atgaatccgttgctctgtttggcttagatagttttggtacatttgatgaacgctatggattatgggtgttggatgacttc
gacggagctcagagttcttggactagacacttaacttttgatcccatggcaggcattaaaagtattttggaatt
back to top
>EU876729.1-SFB5.m1714
acaattcagggttattaaatctctatgtattataggccattgtgatgggatagtttgtttatgtgatggtgacaacatag
ttttatgcaatccagcaataaaggaactcaagcttcttccagaatcatgctttccacagttgatccaatgtggtgtgggg
tttggatatgatcctaaatctaaatattacaaagttcatagaatttcatgtgatggtgaggaaatttatggtgaccgtct
tgttttctttcctcctagagttgaaatatacaccctcagtacagattcttggcgagagatcaataataactatttagaaa
cggaagatactttcttttggcctgattatttccagatgtactggaaaggaatttgttattgggttggatatgagcaacca
aaagaattcgagtcttactttgatagacttgaggatgagcaaaagaagacaatgatctttttgtttgacacaggtgatga
ggtatttcgtaatatattacttccagatagtttatatgagccaccagaatatcggtatatcatgcgcattctagtgtgga
atgaatccgttgctctgtttggcttagatagttttggtacatttgatgaacgctatggattatgggtgttggatgacttc
gacggagctcagagttcttggactagacacttaacttttgatcccatggcaggcattaaaagtattttggaatt
back to top