SFB6, SFB6 (gene) Prunus avium

Gene Overview
Name SFB6
Gene Symbol SFB6
Type gene
Organism Prunus avium
Synonym S-locus F-Box protein 6
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPrunus aviumgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFB6AB096858.1-SFB6.m1Prunus aviummRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB096858.1-SFB6.m1 N/A AB096858.1

Sequence(s):
>AB096858.1-SFB6.m11128
atgacattcacactacgtaagaaagatatcttaatcgacatcctagtaagactacctgcaaaatcccttgttcggtttct
gtgtacatgcaagtcatggattgatttgattggcagctccagttttatcagcacacaccttcataggaatgccacaaaac
atacccatgtctatctactatgcctccaccacccaaattttgaacgaaacgacgaccctgatgacccatatgttgaacaa
gaatttcaatggtctcttttttccaatgaaacatttgaggagtgctccaagttaagccatccctcagggagcacaaaaca
ttatgtgatatatggctcaagcaatggcttagtttgcatttcggaggagatattgaatttcgatagtccaatacacatat
ggaacccctcggttaagaaatttaggactcctccaatgagcaccaacattaacattaaatttagccatgttgctctccaa
ttcgggttccaccctggggttaacgactataaggctgtaaggatgatgcgtaccaacaaaaatgccttggcagttgaggt
ttatagtctcaaaacagactcttggaagatgattgaagcaattcccccttggttaaaatgcacttggcagcatcataagg
gtacattttttaatggagtagcataccatatcattgagaaaggtcctatatgcagcattatgtcattcgattcaggcagt
gatgaattcgaagaattcatagcaccggatgccatttgcagtccatctgagttatgtattgacatttacaaggaacgagt
ttgcttgctttttagcttttattcttgtgacgaagagggcatggtaccaaatgacttatgggttctgcaagaaaaacgat
ggaaacaattgtgtccttttatttatcctgctggtagttatggtacaatcgggataactatagataataaactcttaatg
gtaagaagggatttccttaggggcgcaggagatctgtgtttgtgtaattacgagtccaagcaagtttttgaaacaggaat
tgagttggccgtcatgaaatatggtgaaatcgaattattgtttgcaattacttacatagaaagtttggctttacttaata
aatattga
back to top