SFBB-4, SFBB-4 (gene) Pyrus sinkiangensis

Gene Overview
Name SFBB-4
Gene Symbol SFBB-4
Type gene
Organism Pyrus sinkiangensis
Synonym SFBB-4
Description NA
Comment may be related to the control of plant self-incompatibility
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB-4GU901409.1-SFBB-4Pyrus sinkiangensisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB-4GU901409.1-SFBB-4.m1Pyrus sinkiangensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus sinkiangensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU901409.1-SFBB-4 scaffold01086:55112..56303
GU901409.1
mRNA parsed from NCBI nr database GU901409.1-SFBB-4.m1 scaffold01086:55112..56303
GU901409.1

Sequence(s):
>GU901409.1-SFBB-41191
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaagaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacactatggctgctaactcttggaaggagatcacgattgatatactaagtagaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaagggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaatttggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttctacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttgttattaatcagaataggattgtagattacgtgaaaagtattattctagtcaattga
back to top
>GU901409.1-SFBB-4.m11191
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaagaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacactatggctgctaactcttggaaggagatcacgattgatatactaagtagaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaagggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaatttggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttctacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttgttattaatcagaataggattgtagattacgtgaaaagtattattctagtcaattga
back to top