SFBB-delta, SFBB-delta (gene) Pyrus communis

Gene Overview
Name SFBB-delta
Gene Symbol SFBB-delta
Type gene
Organism Pyrus communis
Synonym SFBBdelta protein
Description NA
Comment S-locus F-box brother protein; SFBBdelta-Cons2
S-locus F-box brother protein; SFBBdelta-Cons1
S-locus F-box brother protein; SFBBdelta-MRB2
S-locus F-box brother protein; SFBBdelta-MRB1
S-locus F-box brother protein; SFBBdelta-AF1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB-deltaHM013896.1-SFBB-delta.m1Pyrus communismRNA
SFBB-deltaHM013895.1-SFBB-delta.m1Pyrus communismRNA
SFBB-deltaHM013884.1-SFBB-delta.m1Pyrus communismRNA
SFBB-deltaHM013883.1-SFBB-delta.m1Pyrus communismRNA
SFBB-deltaHM013876.1-SFBB-delta.m1Pyrus communismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus communisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HM013896.1-SFBB-delta.m1 N/A HM013896.1
mRNA parsed from NCBI nr database HM013895.1-SFBB-delta.m1 N/A HM013895.1
mRNA parsed from NCBI nr database HM013884.1-SFBB-delta.m1 scaffold04181:66..979
HM013884.1
mRNA parsed from NCBI nr database HM013883.1-SFBB-delta.m1 N/A HM013883.1
mRNA parsed from NCBI nr database HM013876.1-SFBB-delta.m1 N/A HM013876.1

Sequence(s):
>HM013896.1-SFBB-delta.m1914
ttttcccagaccagagttggaaacaagaagttttctggtccacgattaatctttccattgatagtgatgaacacaacctt
cattatgatgttgaggacctaattataccgtttccattggaagatcatgattttgtactgattttcggttattgcaatgg
ggttgtctgtgtagatgcagggaaacatgttcttttatgcaatcctgcaacgagagaatttaggcaacttcccgattcat
gccttcttaaaccccctcccaagggaaaattcgaattggaaacgaactttcaagcattaggatttggctatgattgcaat
actaaagaatacaaggttgtgcgaattgtagaaaattgtgagtattcagatgatgagcaaacattttatcatcgtattgc
acttcctcacacagctgaggtatacactacggctgctaactcttggaaagagatcaagattgatatatcaattaaaacct
atcattgttcttgttcagtgtacttgaagggattttgttattggtttgccagcgataacgaggaatacatactttcattt
tatttaggtgatgagacatttcatataatacaattgccttctaggagagaatccggttttacgtttgattatatttttct
ccgaaatgaatcccttgcgtctttttgctctccctacaatccaagtgaggattctaaattatttgaaatatgggtaatgg
acgactatgatggaattaggagttcatggacaaaactcataaccgttggaccctttcaaggcattgagtatcctttgaca
ctttggaaatgtgacgagcttcttatgcttgcatccgatggaagagctacctcgtataattctagcaccagaaatcttaa
gtatctccatattcctcctattctcaataaggtt
back to top
>HM013895.1-SFBB-delta.m1914
ttttcccagaccagagttggaaacaagaagttttctggtccgcgattaatctttccattgatagtgatgagcataacctt
cattatgatgttgaggacttaattataccgtttccattggaagatcatgattttgtactgatttttggttattgtaatgg
gattatttgtgtagatgcagggaaaaatgttcttttatgcaatcctgcaatgagagaatttaggcaacttccggattcat
gccttcttctaccccctcccaagggaaaattcgaattggaaacgacctttcaagcattgggatttggctatgactgcaat
tctaaagaatacaaagttgtgcaaattatagaaaattgtgagtattcagatgatgagcaaacatttcatcatcgtattgc
tcttcctcacacagctgaggtatacaccacggctgctaactcttggaaagagatcaagattgatatatcaagtcaaacct
atcattgttcttgttcggtgtacttgaagggattttgttattggtttgcaagcgatagcgaggaatacatactttcattt
tatttaggtgatgagacatttcatataatacaattgccttctaggagagaatccggtttttcatttgattatatttttct
ccgaaatgaatcccttgcttctttttgctctccctacaatccaagtgaggattctaaattatttgaaatatgggtaatgg
atgactatgatggagttaagagttcatggacaaaactcctaactgttggaccctttaaaggcattgagtatccattgaca
ctttggaaatgtgacgagcttcttatgcttgcttccgatggaagagccacctcttataattctagtacaggaaatctcaa
gtatcttcatattcctcctattctcagtaaggtt
back to top
>HM013884.1-SFBB-delta.m1914
ttttcccagaccagagttggaaacaagaagttttctggtccacgattaatctttctattgatagcgatgagcataacctt
cattatgatgttgaggacctaattataccgtttccattggaagatcatgattttgtactgatttttggttattgcaatgg
gattatctgtgtagatgtagggaaaaatgttcttttatgcaatcctgcaacaagagaatttaggcaacttcccaattcat
gccttcttctaccccctcccaagggaaaattcgagttggaaacgacctttcaagcattgggatttggctatgactgcaat
gctaaagaatacaaggttgtgcgaattatagaaaattgtgagtattcagatgatgagcaaacatttcatcatcgtattgc
tcttcctcacacagctgaggtatacacaacggctgctaactcttggaaagagatcaagattgatatatcaagtcaaactt
atcattgttcttgttcagtgtacttgaagggattttgttattggtttgcaagcgatagcgaggaatacatactttcattt
tatttaggtgatgagacatttcatataatacaattgccttctaggaaagaatccggttttacgtttgattatatttttct
ccgaaatgaatccctcgcttctttttgctctccctacagtccaagtgaggattctaaattatttgaaatttgggtaatgg
atgactttgatggagttaagagttcatggacaaaactcctaaccattggaccctttaaaggcattgagtatccattgaca
ctttggaaatgtgatgagcttcttatgcttgcgtccgatggaagagccacctcttataattctagtaccggaaatctcaa
atatcttcatattcctcctattctcagtaaggtt
back to top
>HM013883.1-SFBB-delta.m1914
ttttcccagaccagagttggaaacaagaagttttctggtccactattgatctttccattgatagtgatgagcataacctt
cattatgatgtggaggacctaattataccgtttccattggaagatcatgattttgtactgatttttggttactgcaatgg
gattgtttgtgtagatgtagggaaaaatgtaactttatgcaatcctgcaacgagagaatttaggcaacttcccgattcat
gccttcttctaccccctcccaagggaaaatttgaattggaaacgacctttctagcgttgggatttggctacgactgcaag
tctaaagaatacaaggttgtgcgaattatagaaaattgtgagtattcagatgatgagcaaacatttcatcatcgtattgc
tcttcctcacacagctgaggtatacaccacggctgctaactcttggaaagagatcaagtttgatatatcaagtcaaacct
atcattgttcttgttcagtgtacttgaagggtttttgttattggtttgcaagcgataacgaggaatacatactttcattt
tatttaggtgatgagacatttcatataatacaattgccttctaggagagaatccggttttacgtttgattatatttttct
ccaaaatgaatcccttgcttctttttgctctccctacagtccaagtgaggattctaaattatttgaaatatgggtaatgg
atgactatgatggagttaagagttcatggacaaaactcctaactgttggaccttttaaaggcattgagtatccattgaca
ctttggaaatttgacgagcttcttatgcttgcgtccgatggaaaagccacctcttataattctagtaccggaaatctcaa
gtatcttcatattcctcccattctcaataaggtt
back to top
>HM013876.1-SFBB-delta.m1914
ttttcccagaccagagttggaaacaagaagttttctggtccacgattaatctttccattgatagtgacgagcataacctt
cattatgatgttgaggacctaattataccgtttccattggaagatcatgattttgtactgattttcggctattgcaatgg
gattatctgtgtagatgcagggaaaaatgttcttttatgcaatcctgcaacgagagaatttaggcaacttcccaattcat
gccttcttctaccccctcccaagggaaaatttgaattggaaacgacctttcaagcattgggatttggctatgactgcaat
gctaaagaatacaaggttgtgcgaattatagaaaattgtgagtattcagacgatgagcaaacatttcatcatcgtattgc
tcttcctcatacagctgaggtatacaccacggctgctaactcttggaaagaaatcaagattgatataccaagtcaaacct
atcattgttcttgttcagtgtacttgaagggattttgttattggtttgcaagcgatagcgaggaatacatactttcattt
tatgtaagtgatgaaacatttcatataatacaattgccttctaggagagaatccggttttacgtttgattatatttttct
ccgaaatgaatcccttgcttctttttgctctccctacaatccaagtgaggattttaaattatttgaaatatgggtaatgg
acaactatgatggagataagactttatggacaaaactcctaaccattggaccctttaaaggcattgagtatccattggca
ctttggaaatatgacgaggttcttatgcttgcgtctgacggaagagccacctcttataattctggtatcggaaatctcaa
gtatcttcatattcctcctgttctcaataaggtt
back to top