SFBB-epsilon, SFBB-epsilon (gene) Pyrus pyrifolia

Gene Overview
Name SFBB-epsilon
Gene Symbol SFBB-epsilon
Type gene
Organism Pyrus pyrifolia
Synonym SFBBepsilon protein
Description NA
Comment S-locus F-box brother protein; SFBBepsilon-Kum1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB-epsilonHM013913.1-SFBB-epsilon.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HM013913.1-SFBB-epsilon.m1 scaffold07498:2458..3631
HM013913.1

Sequence(s):
>HM013913.1-SFBB-epsilon.m11173
atgtctcaggtgtgtgaaagtgagactcctgaagataaagtggtcgaaatcctgtctaagttgccgcccaagtctctgat
gagattcaaatgcatacgcaagtcttggtgcactatcatctgtagtccaagttttgtggccaaacacctcagcaattcca
tggacaacaaactctcatccaccgcttgtatccttctctaccgttgtcaggttcatgttttcacgaacacgagttggaaa
caagacgttttctggtgcatgattaatctttccattgatagtgataaccttcattatgatgttgagaacctaaatatacc
gtttccaatggaagatgaagacaacgtagagcttcacggttattgcaatgggattgtctgtttaatagtagggaaaaatg
ttcttttatgcaatcctgcaacaggagaattcaggcaacttccggattcatcccttcttctaccccttcccaagggaaga
ttcggattggaaacgatctttaagggaatgggatttggttatgattgcaaagctaaagaatacaaggttgtgcgaattat
agaaaattgtgattgtgagtattcggaagatggagaatcatactatgagcgtattcttcttcctcacacggctgaggtat
acaccacgactactaactcttggaaagagatcaagattgatatatcaattgaaactcgttggtattgcattcccttttct
ggttcagtgtacttgaagggattttgttattggtttgcatatgataacggggagtacgtattttcatttgatttaggtga
tgagatatttcatagaatagaattgccttctaggagagaatccgatttcaagttttatggtatttttctgtataatgaat
ctgtcgcttcgtattgctatcgtcatgaagatgattgtgaattatttgaaatatggataatggacgactgtgatggagtt
cagagttcatggacaaaattgctaaccattggaccccttaaagacattgattatccattgacaccttggaaatgtgacga
gattcttatgcttggctcatatggaagagctgcctcttgtaattctattactggaaatctcacgtatcttcatattcctc
ctattatcaaatggatgatgaattatgtgaaaagtattgttccagtcaagtga
back to top