SFBB13-beta, SFBB13-beta (gene) Pyrus x bretschneideri

Gene Overview
Name SFBB13-beta
Gene Symbol SFBB13-beta
Type gene
Organism Pyrus x bretschneideri
Synonym SFBB13-beta
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus x bretschneiderigene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB13-betaEU979320.1-SFBB13-beta.m1Pyrus x bretschneiderimRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EU979320.1-SFBB13-beta.m1 scaffold02780:22101..23289
EU979320.1

Sequence(s):
>EU979320.1-SFBB13-beta.m11188
atgtctcaggtgcatgaaagtgaaactcctgaagataaggtggtcgaaattttgtccaggttgccatccaagtctctgat
gcgattcaaatgcatacgcaagtcttggtgcactctcatcaatggtccaagttttgtggccaaacacctcaacaattccg
tggacaacaaacgctcgtccaacacttgtatccttctcaaccgttctcagatgcccgttttcccagacaacagttggaaa
tatgaagttttttggtccatgattagtctttccattgatagtgatgagcacaaccttcattatgatgttgaggacctaaa
tataccgtttccaatggaagaccatcatcctgtagtgattcacggtcattgcaatgggattgtctgtgtaataacaggga
aaaatgttgttttatgcaatcctgcaattggggaattcaggcaacttcccgattgcctccttctaccccttcccaacata
aaattccaattggagacgagctttggaggattgggattcggctatgattgcaaagctaaagaatacaaggttgtgcgaat
tacagaaaattgtgagtattcagatgctgaacgaacatattaccatcgtattgatcttcctcatacggctcaggtataca
ccacgactgctaactcttggaaagagataaagattgatatatcaagtaaaagctatcttgattcttgtccagtgtacttg
aagggattttgttattggattgcaaatgatggcgaggaattcatactttcatttgatttaagtgatgagatatttcatag
aatacaaatgcctcttgggagagaatccagtttgcagttttgtaatctttttttgtataatgaatccctcgcttgttttt
gctctctttacggtccaagtggcaattctagattatttgaaatatttgaaatatgggtaatggacgactatcacggagtt
aagagttcatggacaaaacttctggccattggaccctttaagcacaatgagaatccattgacattttggaaaagtgacga
gtttcttatggttacgtcagatagaagagtcacctcttataattcaagtaccggaaatctcaagtatcctcttattcctc
ctattatgaatgaggttatagatttacaagctcttatttacgtggaaagtattgttccagtcaattga
back to top