SFBB13, SFBB13 (gene) Sorbus aucuparia

Gene Overview
Name SFBB13
Gene Symbol SFBB13
Type gene
Organism Sorbus aucuparia
Synonym SFBB13
Description NA
Comment allele linked with Sc-RNase
allele linked with S22-RNase
allele linked with Sa-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB13KC701707.1-SFBB13Sorbus aucupariagene
SFBB13KC701706.1-SFBB13Sorbus aucupariagene
SFBB13KC701660.1-SFBB13Sorbus aucupariagene
SFBB13KC701643.1-SFBB13Sorbus aucupariagene
SFBB13KC701620.1-SFBB13Sorbus aucupariagene
SFBB13KC701619.1-SFBB13Sorbus aucupariagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB13KC701707.1-SFBB13.m1Sorbus aucupariamRNA
SFBB13KC701706.1-SFBB13.m1Sorbus aucupariamRNA
SFBB13KC701660.1-SFBB13.m1Sorbus aucupariamRNA
SFBB13KC701643.1-SFBB13.m1Sorbus aucupariamRNA
SFBB13KC701620.1-SFBB13.m1Sorbus aucupariamRNA
SFBB13KC701619.1-SFBB13.m1Sorbus aucupariamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBSorbus aucupariagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KC701707.1-SFBB13 N/A KC701707.1
gene parsed from NCBI nr database KC701706.1-SFBB13 N/A KC701706.1
gene parsed from NCBI nr database KC701660.1-SFBB13 N/A KC701660.1
gene parsed from NCBI nr database KC701643.1-SFBB13 N/A KC701643.1
gene parsed from NCBI nr database KC701620.1-SFBB13 N/A KC701620.1
gene parsed from NCBI nr database KC701619.1-SFBB13 N/A KC701619.1
mRNA parsed from NCBI nr database KC701707.1-SFBB13.m1 N/A KC701707.1
mRNA parsed from NCBI nr database KC701706.1-SFBB13.m1 N/A KC701706.1
mRNA parsed from NCBI nr database KC701660.1-SFBB13.m1 N/A KC701660.1
mRNA parsed from NCBI nr database KC701643.1-SFBB13.m1 N/A KC701643.1
mRNA parsed from NCBI nr database KC701620.1-SFBB13.m1 N/A KC701620.1
mRNA parsed from NCBI nr database KC701619.1-SFBB13.m1 N/A KC701619.1

Sequence(s):
>KC701707.1-SFBB13381
ttcatgccttcttttatcttcccgtcctaagggaaaattccaattggagtcgatctttggaggattgggattcggttatg
attgcaaagctaaagaatacaaggttgtgcaaattatagaaaattgtgagtattcagatgatcagcaatactattatcat
cgtattgctcttcctcacacagctgaggtatataccatgactgctaactcttggagagtgatcaggattgatatatcaag
tgaaacctatcattattcttcttcagtgtacttgaatggatttgtttattggtttgctattgatggcgagaaatacatac
tttcatttgatttaggtgatgagatatttcatagaatacaattgccatctaggagagaatc
back to top
>KC701706.1-SFBB13381
ttcatgccttcttttaccttcccgtcctaagggaaaattccaattggagtcgatctttggaggattgggattcggttatg
attgcaaagctaaagaatacaaggttgtgcaaattatagaaaattgtgagtattcagatgatcagcaatactattatcat
cgtattgctcttcctcacacggctgaggtatataccatggctgctaactcttggagagtgatcaagattgatatatcaag
tgaaacctatcattattcttcttcagtgtacttgaatggatttttttattggtttgcaattgatggcgagaaatacatac
tttcatttgatttagatgatgagatatttcatagaatacaattgccttctaggagagaatc
back to top
>KC701660.1-SFBB13855
aaatgcatacgcaagtcttggtgcacgctcatcaatagtccaagttttgtggccaaacacctcaacaattccatggacaa
caaactatcatcatccacttgcatccttctcagccgttctcaggctcatgttttcccggataacagttggaaaccagaag
ttttctggtccatgattaatctttccattgatagtgatgagcacaaccttcattatgatgttgaggacctaaatataccg
tttccattggaaggtcatgattttgtacagattgagggctattgcaatgggattgtctgtgtaatagcagggacaagtct
ttatttgataaatgttcttttatgcaatcctgcaacggggaaattcaggcaacttcccccttcatgccttcttttacctt
ctcgtcctaagggaaaattccaattggagtcgatctttggaggattgggatttggttatgattgcaaagctaaagaatac
aaggttgtgcaaattatagaaaattgtgagtattctgatgatcagcaatactattatcatcgtattgctcttcctcacac
ggctgaggtatataccatggctgctaactcttggagagtgatcaacattgatatatcaagtgaaacctatcattattctt
cttcagtgtacttgaatggatttttttattggtttgctattgatggcgagaaatacatactttcatttgatttaggtgat
gagatatttcatagaatacaattgccttctaggaaagaatcggattttgagttttctaatatttttctgtgtaataaatc
gattgcttctttttgctcttgttgcgacccaagtgatgaggattctacattatgt
back to top
>KC701643.1-SFBB13855
aaatgcatacgcaagtcttggtgcacgctcatcaatagtccaagttttgtggccaaacacctcaacaattccatggacaa
caaactatcatcatccacttgcatccttctcagccgttctcaggctcatgttttcccggataacagttggaaaccagaag
ttttctggtccaagattaatctttccattgatagtgaagaacacaaccttcattatgatgttgaggacctaaatataccg
tttccattggaaggtcatgattttgtacagattgagggctattgcaatgggattgtctgtgtaatagcagggacaagtct
ttatttgatacatgttattttatgcaatcctgcaacggggaaattcaggcaacttcccccttcatgccttcttttacctt
cccgtcctaagggaaaattccaattggagtcgatctttggaggattgggatttggttatgattgcaaagctaaagaatac
aaggttgtgcaaattatagaaaattgtgagtattctgatgatcagcaatactattatcatcgtattgctcttcctcacac
ggctgaggtatataccatggctgctaactcttggagagtgatcaacattgatatatcaagtgaaacctatcattattctt
cttcagtgtacttgaatggatttttttattggtttgctattgatggcgagaaatacgtactttcatttgatttaggtgat
gagatatttcatagaatacaattgccttctaggaaagaatcggattttgagttttctaatatttttctgtgtaataaatc
gattgcttctttttgctcttgttgcgacccaagtgatgaggattctacattatgt
back to top
>KC701620.1-SFBB13855
aaatgcatacgcaagtcttggtgcacgctcatcaatagtccaagttttgtggccaaacacctcaacaattccatggacaa
caaactatcatcatccacttgcatccttctcagccgttctcaggctcatgttttcccggataacagttggaaaccagaag
ttttctggtccaagattaatctttccattgatagtgaagaacacaaccttcattatgatgttgaggacctaaatataccg
tttccattggaaggtcatgattttgtacagattgagggctattgcaatgggattgtctgtgtaatagcagggacaagtct
ttatttgatacatgttattttatgcaatcctgcaacggggaaattcaggcaacttcccccttcatgccttcttttacctt
cccgtcctaagggaaaattccaattggagtcgatctttggaggattgggatttggttatgattgcaaagctaaagaatac
aaggttgtgcaaattatagaaaattgtgagtattctgatgatcagcaatactattatcatcgtattgctcttcctcacac
ggctgaggtatataccatggctgctaactcttggagagtgatcaacattgatatatcaagtgaaacctatcattattctt
cttcagtgtacttgaatggatttttttattggtttgctattgatggcgagaaatacgtactttcatttgatttaggtgat
gagatatttcatagaatacaattgccttctaggaaagaatcggattttgagttttctaatatttttctgtgtaataaatc
gattgcttctttttgctcttgttgcgacccaagtgatgaggattctacattatgt
back to top
>KC701619.1-SFBB13855
aaatgcatacgcaagtcttggtacactctcatgaatagtccaagttttgtggccaaacacctcaacaattccatggacaa
caagctatcatcatccacttgcatccttctcagccgttctcaggcttatgttttcccggataacagttggaaaccagaag
ttttctggtccatgattaatctttccattgatagtgatgagcacaaccttcactatgatgttgaggacctaaatatacca
tttccattggaaggtcatgattttgtacagattgagggatattgcaatgggattgtctgtgtaatagcagggacaagtct
ttatttgataaatgttcttttatgcaatcctgcaacggggaaattcaggcaacttcctccttcctgccttcttttacctt
gccgtcctaagggaaaattccaattggagtcgatctttggaggattgggattcggttatgattgcaaagctaaagaatac
aaggttgtgcaaattatagaaaattgtgagtattcagatgatcagcaatactattatcatcgtattgctcttcctcacac
ggctgaggtatataccatggctgctaactcttggagagtgatcaagattgatatatcaagggaaacctatcattattctt
cttcagtgtacttgaatggatttttttattggtttgcaattgatggcgagaaatacatactttcatttgatttaggtgat
gagatatttcatagaatacaattgccttctaggagagaatcggattttgagttttctaatatttttctgtgtaataaatc
gattgcttctttttgctcttgttgcgacccaagtgatgaggatactacattatgt
back to top
>KC701707.1-SFBB13.m1381
ttcatgccttcttttatcttcccgtcctaagggaaaattccaattggagtcgatctttggaggattgggattcggttatg
attgcaaagctaaagaatacaaggttgtgcaaattatagaaaattgtgagtattcagatgatcagcaatactattatcat
cgtattgctcttcctcacacagctgaggtatataccatgactgctaactcttggagagtgatcaggattgatatatcaag
tgaaacctatcattattcttcttcagtgtacttgaatggatttgtttattggtttgctattgatggcgagaaatacatac
tttcatttgatttaggtgatgagatatttcatagaatacaattgccatctaggagagaatc
back to top
>KC701706.1-SFBB13.m1381
ttcatgccttcttttaccttcccgtcctaagggaaaattccaattggagtcgatctttggaggattgggattcggttatg
attgcaaagctaaagaatacaaggttgtgcaaattatagaaaattgtgagtattcagatgatcagcaatactattatcat
cgtattgctcttcctcacacggctgaggtatataccatggctgctaactcttggagagtgatcaagattgatatatcaag
tgaaacctatcattattcttcttcagtgtacttgaatggatttttttattggtttgcaattgatggcgagaaatacatac
tttcatttgatttagatgatgagatatttcatagaatacaattgccttctaggagagaatc
back to top
>KC701660.1-SFBB13.m1855
aaatgcatacgcaagtcttggtgcacgctcatcaatagtccaagttttgtggccaaacacctcaacaattccatggacaa
caaactatcatcatccacttgcatccttctcagccgttctcaggctcatgttttcccggataacagttggaaaccagaag
ttttctggtccatgattaatctttccattgatagtgatgagcacaaccttcattatgatgttgaggacctaaatataccg
tttccattggaaggtcatgattttgtacagattgagggctattgcaatgggattgtctgtgtaatagcagggacaagtct
ttatttgataaatgttcttttatgcaatcctgcaacggggaaattcaggcaacttcccccttcatgccttcttttacctt
ctcgtcctaagggaaaattccaattggagtcgatctttggaggattgggatttggttatgattgcaaagctaaagaatac
aaggttgtgcaaattatagaaaattgtgagtattctgatgatcagcaatactattatcatcgtattgctcttcctcacac
ggctgaggtatataccatggctgctaactcttggagagtgatcaacattgatatatcaagtgaaacctatcattattctt
cttcagtgtacttgaatggatttttttattggtttgctattgatggcgagaaatacatactttcatttgatttaggtgat
gagatatttcatagaatacaattgccttctaggaaagaatcggattttgagttttctaatatttttctgtgtaataaatc
gattgcttctttttgctcttgttgcgacccaagtgatgaggattctacattatgt
back to top
>KC701643.1-SFBB13.m1855
aaatgcatacgcaagtcttggtgcacgctcatcaatagtccaagttttgtggccaaacacctcaacaattccatggacaa
caaactatcatcatccacttgcatccttctcagccgttctcaggctcatgttttcccggataacagttggaaaccagaag
ttttctggtccaagattaatctttccattgatagtgaagaacacaaccttcattatgatgttgaggacctaaatataccg
tttccattggaaggtcatgattttgtacagattgagggctattgcaatgggattgtctgtgtaatagcagggacaagtct
ttatttgatacatgttattttatgcaatcctgcaacggggaaattcaggcaacttcccccttcatgccttcttttacctt
cccgtcctaagggaaaattccaattggagtcgatctttggaggattgggatttggttatgattgcaaagctaaagaatac
aaggttgtgcaaattatagaaaattgtgagtattctgatgatcagcaatactattatcatcgtattgctcttcctcacac
ggctgaggtatataccatggctgctaactcttggagagtgatcaacattgatatatcaagtgaaacctatcattattctt
cttcagtgtacttgaatggatttttttattggtttgctattgatggcgagaaatacgtactttcatttgatttaggtgat
gagatatttcatagaatacaattgccttctaggaaagaatcggattttgagttttctaatatttttctgtgtaataaatc
gattgcttctttttgctcttgttgcgacccaagtgatgaggattctacattatgt
back to top
>KC701620.1-SFBB13.m1855
aaatgcatacgcaagtcttggtgcacgctcatcaatagtccaagttttgtggccaaacacctcaacaattccatggacaa
caaactatcatcatccacttgcatccttctcagccgttctcaggctcatgttttcccggataacagttggaaaccagaag
ttttctggtccaagattaatctttccattgatagtgaagaacacaaccttcattatgatgttgaggacctaaatataccg
tttccattggaaggtcatgattttgtacagattgagggctattgcaatgggattgtctgtgtaatagcagggacaagtct
ttatttgatacatgttattttatgcaatcctgcaacggggaaattcaggcaacttcccccttcatgccttcttttacctt
cccgtcctaagggaaaattccaattggagtcgatctttggaggattgggatttggttatgattgcaaagctaaagaatac
aaggttgtgcaaattatagaaaattgtgagtattctgatgatcagcaatactattatcatcgtattgctcttcctcacac
ggctgaggtatataccatggctgctaactcttggagagtgatcaacattgatatatcaagtgaaacctatcattattctt
cttcagtgtacttgaatggatttttttattggtttgctattgatggcgagaaatacgtactttcatttgatttaggtgat
gagatatttcatagaatacaattgccttctaggaaagaatcggattttgagttttctaatatttttctgtgtaataaatc
gattgcttctttttgctcttgttgcgacccaagtgatgaggattctacattatgt
back to top
>KC701619.1-SFBB13.m1855
aaatgcatacgcaagtcttggtacactctcatgaatagtccaagttttgtggccaaacacctcaacaattccatggacaa
caagctatcatcatccacttgcatccttctcagccgttctcaggcttatgttttcccggataacagttggaaaccagaag
ttttctggtccatgattaatctttccattgatagtgatgagcacaaccttcactatgatgttgaggacctaaatatacca
tttccattggaaggtcatgattttgtacagattgagggatattgcaatgggattgtctgtgtaatagcagggacaagtct
ttatttgataaatgttcttttatgcaatcctgcaacggggaaattcaggcaacttcctccttcctgccttcttttacctt
gccgtcctaagggaaaattccaattggagtcgatctttggaggattgggattcggttatgattgcaaagctaaagaatac
aaggttgtgcaaattatagaaaattgtgagtattcagatgatcagcaatactattatcatcgtattgctcttcctcacac
ggctgaggtatataccatggctgctaactcttggagagtgatcaagattgatatatcaagggaaacctatcattattctt
cttcagtgtacttgaatggatttttttattggtttgcaattgatggcgagaaatacatactttcatttgatttaggtgat
gagatatttcatagaatacaattgccttctaggagagaatcggattttgagttttctaatatttttctgtgtaataaatc
gattgcttctttttgctcttgttgcgacccaagtgatgaggatactacattatgt
back to top