SFBB15, SFBB15 (gene) Sorbus aucuparia

Gene Overview
Name SFBB15
Gene Symbol SFBB15
Type gene
Organism Sorbus aucuparia
Synonym SFBB15
Description NA
Comment allele linked with Sc-RNase
allele linked with S22-RNase
allele linked with Sa-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB15KC701712.1-SFBB15Sorbus aucupariagene
SFBB15KC701661.1-SFBB15Sorbus aucupariagene
SFBB15KC701649.1-SFBB15Sorbus aucupariagene
SFBB15KC701631.1-SFBB15Sorbus aucupariagene
SFBB15KC701624.1-SFBB15Sorbus aucupariagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB15KC701712.1-SFBB15.m1Sorbus aucupariamRNA
SFBB15KC701661.1-SFBB15.m1Sorbus aucupariamRNA
SFBB15KC701649.1-SFBB15.m1Sorbus aucupariamRNA
SFBB15KC701631.1-SFBB15.m1Sorbus aucupariamRNA
SFBB15KC701624.1-SFBB15.m1Sorbus aucupariamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBSorbus aucupariagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KC701712.1-SFBB15 N/A KC701712.1
gene parsed from NCBI nr database KC701661.1-SFBB15 N/A KC701661.1
gene parsed from NCBI nr database KC701649.1-SFBB15 N/A KC701649.1
gene parsed from NCBI nr database KC701631.1-SFBB15 N/A KC701631.1
gene parsed from NCBI nr database KC701624.1-SFBB15 N/A KC701624.1
mRNA parsed from NCBI nr database KC701712.1-SFBB15.m1 N/A KC701712.1
mRNA parsed from NCBI nr database KC701661.1-SFBB15.m1 N/A KC701661.1
mRNA parsed from NCBI nr database KC701649.1-SFBB15.m1 N/A KC701649.1
mRNA parsed from NCBI nr database KC701631.1-SFBB15.m1 N/A KC701631.1
mRNA parsed from NCBI nr database KC701624.1-SFBB15.m1 N/A KC701624.1

Sequence(s):
>KC701712.1-SFBB15335
gattcacggtcattgcaatgggattgtctgtgtaataacagggaaaaatgttgttttatgcaatcctgcaattggggaat
tcaggcaacttcccgattgcctccttctaccccttcccaacataaaattccaattggagacgagctttggaggattggga
ttcggctatgattgcaaagctaaagaatacaaggttgtgcgaattacagaaaattgtgagtattcagatgctgaacgaac
atattaccatcgtattgatcttcctcatacggctcaggtatacaccacgactgctaactcttggaaagagatcaagattg
atatatcaagtaaaa
back to top
>KC701661.1-SFBB15831
aaatgcatacgcaagtcttggtgcactctcatcaatagtccaagttttgtggccaaacacctcaacaattccgtggacaa
caaacgctcatccaatacttgtatccttctcaaccgttctcagatgcccgttttcccagacaacagttggaaatatgaag
ttttttggtccatgattagtctttccattgatagtgatgagcacaaccttcattatgatgttgaggacctaaatataccg
tttccaatggaagaccatcatcctgtagtgattcacggtcattgcaatgggattgtctgtgtaataacagggaaaaatgt
tgttttatgcaatcctgcaattggggaattcaggcaacttcccgattgcctccttctaccccttcccaacataaaattcc
aattggagacgagctttggaggattgggattcggctatgattgcaaagctaaagaatacaaggttgtgcgaattacagaa
aattgtgagtattcagatgctgaacgaacatattaccatcgtattgatcttcctcatacggctcaggtatacaccacgac
tgctaactcttggaaagagatcaagattgatatatcaagtaaaagctatcttgattcttgtccattgtacttgaagggat
tttgttattggattgcaaatgatggcgaggaattcatactttcatttgatttaggtgatgagatatttcatagaatacaa
atgcctcttgggagagaatccagtttgcagttttgtaatctttttctgtataatgaatccctcgcttgtttttgctctct
ttacggtccaagtgacaattctagattattt
back to top
>KC701649.1-SFBB15831
aaatgcatacgcaagtcttggtgcactctcatcaatagtccaagctttgtggccaaacacctcaacaattccgtggacaa
caaacgctcatccaatacttgtatccttctcgaccgttctcagatgcccgttttcccagacaacagttggaaatatgaag
ttttttggtccatgattagtctttccattgatagtgatgagcacaaccttcattatgatgttgaggacctaaatataccg
tttccaatggaagaccatcatcctgtagtgattcacggtcattgcaatgggattgtctgtgtaataacagggaaaaatgt
tgttttatgcaatcctgcaattggggaattcaggcaacttcccgattgcctccttctaccccttcccaacataaaattcc
aattggagacgagctttggaggattgggattcggctatgattgcaaagctaaagaatacaaggttgtgcgaattacagaa
aattgtgagtattcagatgctgaacgaacatattaccatcgtattgatcttcctcatacggctcaggtatacaccacgac
tgctaactcttggaaagagatcaagattgatataccaagtaaaagctatcttgattcttgtccattgtacttgaagggat
tttgttattggattgcaaatgatggcgaggaattcatactttcatttgatttgggtgatgagatatttcatagaatacaa
atgcctcttgggagagaatccagtttgcagttttgtaatctttttctgtataatgaatccctcgcttgtttttgctctct
ttacggtccaagtgacaattctagattattt
back to top
>KC701631.1-SFBB15831
aaatgcatacgcaagtcttggtgcactctcatcaatagtccaagctttgtggccaaacacctcaacaattccgtggacaa
caaacgctcatccaatacttgtatccttctcgaccgttctcagatgcccgttttcccagacaacagttggaaatatgaag
ttttttggtccatgattagtctttccattgatagtgatgagcacaaccttcattatgatgttgaggacctaaatataccg
tttccaatggaagaccatcatcctgtagtgattcacggtcattgcaatgggattgtctgtgtaataacagggaaaaatgt
tgttttatgcaatcctgcaattggggaattcaggcaacttcccgattgcctccttctaccccttcccaacataaaattcc
aattggagacgagctttggaggattgggattcggctatgattgcaaagctaaagaatacaaggttgtgcgaattacagaa
aattgtgagtattcagatgctgaacgaacatattaccatcgtattgatcttcctcatacggctcaggtatacaccacgac
tgctaactcttggaaagagatcaagattgatataccaagtaaaagctatcttgattcttgtccattgtacttgaagggat
tttgttattggattgcaaatgatggcgaggaattcatactttcatttgatttgggtgatgagatatttcatagaatacaa
atgcctcttgggagagaatccagtttgcagttttgtaatctttttctgtataatgaatccctcgcttgtttttgctctct
ttacggtccaagtgacaattctagattattt
back to top
>KC701624.1-SFBB15831
aaatgcatacgcaagtcttggtgcactctcatcaatagtccaagttttgtggccaaacacctcaacaattccgtggacaa
caaacgctcatccaatacttgtatccttctcaaccgttctcagatgcccgttttcccagacaacagttggaaatatgaag
ttttttggtccatgattagtctttccattgatagtgatgagcacaaccttcattatgatgttgaggacctaaatataccg
tttccaatggaagaccatcatcctgtagtgattcacggtcattgcaatgggattgtctgtgtaataacagggaaaaatgt
tgttttatgcaatcctgcaattggggaattcaggcaacttcccgattgcctccttctgccccttcccaacataaaattcc
aattggagacgagctttggaggattgggattcggctatgattgcaaagctaaagaatacaaggttgtgcgaattacagaa
aattgtgagtattcagatgctgaacgaacatattaccatcgtattgatcttcctcatacggctcaggtatacaccacgac
tgctaactcttggaaagagatcaagattgatatatcaagtaaaagctatcttgattcttgtccagtgtacttgaagggat
tttgttattggattgcaaatgatggcgaggaattcatactttcatttgatttaggtgatgagatatttcatagaatacaa
atgcctcttgggagagaatccagtttgcagttttgtaatctttttctgtataatgaatccctcgcttgtttttgctctct
ttacggtccaagtgacaattctagattattt
back to top
>KC701712.1-SFBB15.m1335
gattcacggtcattgcaatgggattgtctgtgtaataacagggaaaaatgttgttttatgcaatcctgcaattggggaat
tcaggcaacttcccgattgcctccttctaccccttcccaacataaaattccaattggagacgagctttggaggattggga
ttcggctatgattgcaaagctaaagaatacaaggttgtgcgaattacagaaaattgtgagtattcagatgctgaacgaac
atattaccatcgtattgatcttcctcatacggctcaggtatacaccacgactgctaactcttggaaagagatcaagattg
atatatcaagtaaaa
back to top
>KC701661.1-SFBB15.m1831
aaatgcatacgcaagtcttggtgcactctcatcaatagtccaagttttgtggccaaacacctcaacaattccgtggacaa
caaacgctcatccaatacttgtatccttctcaaccgttctcagatgcccgttttcccagacaacagttggaaatatgaag
ttttttggtccatgattagtctttccattgatagtgatgagcacaaccttcattatgatgttgaggacctaaatataccg
tttccaatggaagaccatcatcctgtagtgattcacggtcattgcaatgggattgtctgtgtaataacagggaaaaatgt
tgttttatgcaatcctgcaattggggaattcaggcaacttcccgattgcctccttctaccccttcccaacataaaattcc
aattggagacgagctttggaggattgggattcggctatgattgcaaagctaaagaatacaaggttgtgcgaattacagaa
aattgtgagtattcagatgctgaacgaacatattaccatcgtattgatcttcctcatacggctcaggtatacaccacgac
tgctaactcttggaaagagatcaagattgatatatcaagtaaaagctatcttgattcttgtccattgtacttgaagggat
tttgttattggattgcaaatgatggcgaggaattcatactttcatttgatttaggtgatgagatatttcatagaatacaa
atgcctcttgggagagaatccagtttgcagttttgtaatctttttctgtataatgaatccctcgcttgtttttgctctct
ttacggtccaagtgacaattctagattattt
back to top
>KC701649.1-SFBB15.m1831
aaatgcatacgcaagtcttggtgcactctcatcaatagtccaagctttgtggccaaacacctcaacaattccgtggacaa
caaacgctcatccaatacttgtatccttctcgaccgttctcagatgcccgttttcccagacaacagttggaaatatgaag
ttttttggtccatgattagtctttccattgatagtgatgagcacaaccttcattatgatgttgaggacctaaatataccg
tttccaatggaagaccatcatcctgtagtgattcacggtcattgcaatgggattgtctgtgtaataacagggaaaaatgt
tgttttatgcaatcctgcaattggggaattcaggcaacttcccgattgcctccttctaccccttcccaacataaaattcc
aattggagacgagctttggaggattgggattcggctatgattgcaaagctaaagaatacaaggttgtgcgaattacagaa
aattgtgagtattcagatgctgaacgaacatattaccatcgtattgatcttcctcatacggctcaggtatacaccacgac
tgctaactcttggaaagagatcaagattgatataccaagtaaaagctatcttgattcttgtccattgtacttgaagggat
tttgttattggattgcaaatgatggcgaggaattcatactttcatttgatttgggtgatgagatatttcatagaatacaa
atgcctcttgggagagaatccagtttgcagttttgtaatctttttctgtataatgaatccctcgcttgtttttgctctct
ttacggtccaagtgacaattctagattattt
back to top
>KC701631.1-SFBB15.m1831
aaatgcatacgcaagtcttggtgcactctcatcaatagtccaagctttgtggccaaacacctcaacaattccgtggacaa
caaacgctcatccaatacttgtatccttctcgaccgttctcagatgcccgttttcccagacaacagttggaaatatgaag
ttttttggtccatgattagtctttccattgatagtgatgagcacaaccttcattatgatgttgaggacctaaatataccg
tttccaatggaagaccatcatcctgtagtgattcacggtcattgcaatgggattgtctgtgtaataacagggaaaaatgt
tgttttatgcaatcctgcaattggggaattcaggcaacttcccgattgcctccttctaccccttcccaacataaaattcc
aattggagacgagctttggaggattgggattcggctatgattgcaaagctaaagaatacaaggttgtgcgaattacagaa
aattgtgagtattcagatgctgaacgaacatattaccatcgtattgatcttcctcatacggctcaggtatacaccacgac
tgctaactcttggaaagagatcaagattgatataccaagtaaaagctatcttgattcttgtccattgtacttgaagggat
tttgttattggattgcaaatgatggcgaggaattcatactttcatttgatttgggtgatgagatatttcatagaatacaa
atgcctcttgggagagaatccagtttgcagttttgtaatctttttctgtataatgaatccctcgcttgtttttgctctct
ttacggtccaagtgacaattctagattattt
back to top
>KC701624.1-SFBB15.m1831
aaatgcatacgcaagtcttggtgcactctcatcaatagtccaagttttgtggccaaacacctcaacaattccgtggacaa
caaacgctcatccaatacttgtatccttctcaaccgttctcagatgcccgttttcccagacaacagttggaaatatgaag
ttttttggtccatgattagtctttccattgatagtgatgagcacaaccttcattatgatgttgaggacctaaatataccg
tttccaatggaagaccatcatcctgtagtgattcacggtcattgcaatgggattgtctgtgtaataacagggaaaaatgt
tgttttatgcaatcctgcaattggggaattcaggcaacttcccgattgcctccttctgccccttcccaacataaaattcc
aattggagacgagctttggaggattgggattcggctatgattgcaaagctaaagaatacaaggttgtgcgaattacagaa
aattgtgagtattcagatgctgaacgaacatattaccatcgtattgatcttcctcatacggctcaggtatacaccacgac
tgctaactcttggaaagagatcaagattgatatatcaagtaaaagctatcttgattcttgtccagtgtacttgaagggat
tttgttattggattgcaaatgatggcgaggaattcatactttcatttgatttaggtgatgagatatttcatagaatacaa
atgcctcttgggagagaatccagtttgcagttttgtaatctttttctgtataatgaatccctcgcttgtttttgctctct
ttacggtccaagtgacaattctagattattt
back to top