CBF, JX464668.1-CBF.m1 (mRNA) Prunus persica

Transcript Overview
Unique NameJX464668.1-CBF.m1
OrganismPrunus persica (Peach)
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
CBFJX464668.1-CBFPrunus persicagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
CBFCBFPrunus persicagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JX464668.1-CBF.m1-cds1JX464668.1-CBF.m1-cds1Prunus persicaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
CBFJX464668.1-CBF.p1Prunus persicapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
JX464668 region JX464668:78..797+ NCBI Rosaceae gene and mRNA sequences
scaffold_5 supercontig scaffold_5:10051648..10052367- Prunus persica Whole Genome v1.0 Assembly & Annotation
Property NameValue
ProductC-repeat binding factor
Genbank notetranscription factor which regulates the plant adaptability under cold temperature
The following sequences are available for this feature:

mRNA sequence

>JX464668.1-CBF.m1 ID=JX464668.1-CBF.m1|Name=CBF|organism=Prunus persica|type=mRNA|length=720bp
back to top

protein sequence of CBF

>JX464668.1-CBF.p1 ID=JX464668.1-CBF.p1|Name=CBF|organism=Prunus persica|type=polypeptide|length=239bp
back to top

mRNA from alignment at JX464668:78..797+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JX464668.1-CBF.m1 ID=JX464668.1-CBF.m1|Name=CBF|organism=Prunus persica|type=mRNA|length=720bp|location=Sequence derived from alignment at JX464668:78..797+ (Prunus persica)
atggtcatggacatgatcttcgctcaggtttctgactcggccgaccagcc caggtcgagttcgtcatccgacgcaagcgtgagcaccttacgcacttcgg acgtcatactggcgtcgagcagtccgaagaagcgcgcgggaaggaaggtt ttcaaagagacgaggcacccggtttataggggtgtgaggaggagagacaa caacaagtgggtgtgtgagttgagacagcccaacaagaagaagtccggga tttggctcgggacctatcctacggctgagatggctgctcgtgcccatgac gtggcggcattggcttttaaagggaagcttgcctgcctcaactttgctga ctcgggttggcggctgccggtcgcggcatccatggattccatggatatcc agagggcagctgcggaggccgctgaagggttcagaccggtggagttcggt ggggtttccagcggcagcagtgatgagaaggagagaatggttgtggtgga agagaagaagaagaagcaggctattgtggatatgggaaaaagctgcagca gattaaacttgttttatttggatgaggaggaaatgtttgatatgccaagg ttgattgacaacatggctgaagggcttcttctttctccaccccaatgctt agctggctatttgaattgggatgacatggaaactgaagctgattccaagt tgtggagtttctctatctga
back to top

Coding sequence (CDS) from alignment at JX464668:78..797+

>JX464668.1-CBF.m1 ID=JX464668.1-CBF.m1|Name=CBF|organism=Prunus persica|type=CDS|length=720bp|location=Sequence derived from alignment at JX464668:78..797+ (Prunus persica)
back to top