SFBB28-gamma, SFBB28-gamma (gene) Pyrus sinkiangensis

Gene Overview
Name SFBB28-gamma
Gene Symbol SFBB28-gamma
Type gene
Organism Pyrus sinkiangensis
Synonym SFBB28-gamma
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus sinkiangensisgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB28-gammaEU422960.1-SFBB28-gamma.m1Pyrus sinkiangensismRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EU422960.1-SFBB28-gamma.m1 scaffold01086:55112..56303
EU422960.1

Sequence(s):
>EU422960.1-SFBB28-gamma.m11191
atgtcccagatgcgtgaaagtgaaactcctgaagataggaaggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcttacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacatctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaagagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatgt
accgtttctaaaggatgaccctcatgaagtagagatgcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatgttgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttggaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaatgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagggttgtagattacgtaaaaagtattattctagtcaattga
back to top