SFBB2, SFBB2 (gene) Sorbus aucuparia

Gene Overview
Name SFBB2
Gene Symbol SFBB2
Type gene
Organism Sorbus aucuparia
Synonym SFBB2
Description NA
Comment allele linked with S22-RNase
allele linked with Sc-RNase
allele linked with Sa-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB2KC701647.1-SFBB2Sorbus aucupariagene
SFBB2KC701646.1-SFBB2Sorbus aucupariagene
SFBB2KC701637.1-SFBB2Sorbus aucupariagene
SFBB2KC701636.1-SFBB2Sorbus aucupariagene
SFBB2KC701678.1-SFBB2Sorbus aucupariagene
SFBB2KC701677.1-SFBB2Sorbus aucupariagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB2KC701647.1-SFBB2.m1Sorbus aucupariamRNA
SFBB2KC701646.1-SFBB2.m1Sorbus aucupariamRNA
SFBB2KC701637.1-SFBB2.m1Sorbus aucupariamRNA
SFBB2KC701636.1-SFBB2.m1Sorbus aucupariamRNA
SFBB2KC701678.1-SFBB2.m1Sorbus aucupariamRNA
SFBB2KC701677.1-SFBB2.m1Sorbus aucupariamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBSorbus aucupariagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KC701647.1-SFBB2 N/A KC701647.1
gene parsed from NCBI nr database KC701646.1-SFBB2 N/A KC701646.1
gene parsed from NCBI nr database KC701637.1-SFBB2 N/A KC701637.1
gene parsed from NCBI nr database KC701636.1-SFBB2 N/A KC701636.1
gene parsed from NCBI nr database KC701678.1-SFBB2 N/A KC701678.1
gene parsed from NCBI nr database KC701677.1-SFBB2 N/A KC701677.1
mRNA parsed from NCBI nr database KC701647.1-SFBB2.m1 N/A KC701647.1
mRNA parsed from NCBI nr database KC701646.1-SFBB2.m1 N/A KC701646.1
mRNA parsed from NCBI nr database KC701637.1-SFBB2.m1 N/A KC701637.1
mRNA parsed from NCBI nr database KC701636.1-SFBB2.m1 N/A KC701636.1
mRNA parsed from NCBI nr database KC701678.1-SFBB2.m1 N/A KC701678.1
mRNA parsed from NCBI nr database KC701677.1-SFBB2.m1 N/A KC701677.1

Sequence(s):
>KC701647.1-SFBB2843
aaatgtatacgcaagtcttggtgcacggtcatcaacaatccaagttttatggccaaacacctcagcaattccgttgacaa
caaattctcatcctccacttgtatccttctccatcgttctcagatgcccgttttcccggacagaagttggaaacgagaat
atttctggtccatgattaatctttcccatgatagtgatgagcacaacctttattatgatgttgaagacctaaatatacaa
tttccattggaagatcatgatcatgtatcgattcatggctattgcaatgggattgtctgtctaatagtagggaaaaatgc
tgttttatacaatcctgcaacgagggaactgaagcacctacctgattcatgccttcttctaccttcccctccggagggaa
agttcgaattggaatcgacctttcaaggaatgggatttggctatgatagcaaagctaaagaatacaaggttgtgaaaatt
atagaaaattgtgagtattcagatgatatgcgaacattttctcatcgtattgctcttcctcacacggctgaggtatatgt
cacaactactaactcttggagagtgatcgagattgaaatatcaagtgatacctataactgttcttgttcagtatacttga
agggattttgttattggtttgcaagcgatgacgaggaatacatactttcatttgatttaggtgatgagatatttcataga
atacaattgccttataggaaagaatccgcttttttgttttatgatctttttttgtataatgaatctatcgcttctttttg
ctctcattgtgataaaagtgacaattctggaatattggaaata
back to top
>KC701646.1-SFBB2843
aaatgtatacgcaagtcttggtgcacggtcatcaacaatccaagttttatggccaaacacctcagcaattccgttgacaa
caaattctcatcctctacttgtatccttctccatcgttctcataagcctgttttcccggacagaagttggaaacgagaat
atttctggtccatgattaatctttcccatgatagtgatgagcacaacctttattatgatgttgaggacctaaatatacaa
tttccattggaagatcatgatcttgtatcagttcatggctattgcaatgggattgtctgtctaatagtagggaaaaatgc
tgttttatacaatcctgcaacgagggaactgaagaaactacctgattcatgccttcttctaccttcccctcagaagggaa
aattcgaattggaatcgacctttcaaggaatgggatttggctatgatagcaaagctaaagaatacaaggttgtgaaaatt
atagaaaattgtgagtattcagatgatgagcgaacattttctcatcgtattgctctttgtcacacggctgaggtatatgt
tacgactactaactcttggagagtgatcgagattgaaatatcaagtgatacctataactgttcttgttcagtatacttga
agggattttgttattggtttgcaagcgatgacgaggaatacatactttcatttgatttaggtgatgagatatttcataga
atacaattgccttataggaaagaatccggttttttgttttatgatctttttttatataatgaatctatcgcatctttttg
ctctcattatgataaaagtgacaactctggaatattggaaata
back to top
>KC701637.1-SFBB2843
aaatgtatacgcaagtcttggtgcacggtcatcaacaatccaagttttatggccaaacacctcagcaattccgttgacaa
caaattctcatcctccacttgtatccttctccatcgttctcagatgcccgttttcccggacagaagttggaaacgagaat
atttctggtccatgattaatctttcccatgatagtgatgagcacaacctttattatgatgttgaagacctaaatatacaa
tttccattggaagatcatgatcatgtatcgattcatggctattgcaatgggattgtctgtctaatagtagggaaaaatgc
tgttttatacaatcctgcaacgagggaactgaagcacctacctgattcatgccttcttctaccttcccctccggagggaa
agttcgaattggaatcgacctttcaaggaatgggatttggctatgatagcaaagctaaagaatacaaggttgtgaaaatt
atagaaaattgtgagtattcagatgatatgcgaacattttctcatcgtattgctcttcctcacacggctgaggtatatgt
cacaactactaactcttggagagtgatcgagattgaaatatcaagtgatacctataactgttcttgttcagtatacttga
agggattttgttattggtttgcaagcgatgacgaggaatacatactttcatttgatttaggtgatgagatatttcataga
atacaattgccttataggaaagaatccgcttttttgttttatgatctttttttgtataatgaatctatcgcttctttttg
ctctcattgtgataaaagtgacaattctggaatattggaaata
back to top
>KC701636.1-SFBB2846
acatgtttacgcaagtcttggtgcacggtcatcaacaatccaagttttatggccaaacacctcagcaattccgttgacaa
caaattctcatcctccacttgtatccttctccaccgttctcagatgcccgttttcccggacagaagttggaaacgagaat
atttctggtccatgattaatctttcccatgatagtgatgagcacaacctttattatgatgttgaggacctaaatatacaa
tttccattggaagatcatgatcatgcatcgattcatggctattgcaatgggattgtctgtctaatagtagggaaaaatgc
tgttttatacaatcctgcaacgagggaactgaagcaactacctgattcatgccttcttctaccttcccctccggagggaa
aattcgaattggaatcgacctttcaaggaatgggatttggctatgatagcaaagctaaagaatacaaggttgtgaaaatt
atagaaaattgtgagtattcagatgatatgcgaacattttcccatcgtattgctcttcctcacacggctgaggtatatgt
cacgactactaactcttggagagtgatcgagattgaaatatcaagtgatacctataattgttcttgttcagtatacttga
agggattttgttattggtttgcaagcgatgacgaggaatacatactttcatttgatttaggtgatgagatatttcataga
atacaattgccttataggaaagaatccggttttttgttttatgatctttttctgtataatgaatccatcgcttctttttg
ctctcattatgataaaagtgacaattctggaatgttggaaatactt
back to top
>KC701678.1-SFBB2679
atcgttctcatatgcctgttttcccggacagaagttggaaacgagaatatttctggtccatgattaatctttcccatgat
agtgatgagcacaacctttattatgatgttgaggacctaaatatacaatttccattggaagatcatgatcttgtatcaat
tcatggctattgcaatgggattatctgtctaatagtagggaaaaatgctattttatacaatcctgcaacgagggaactga
agcaactacctgattcatgccttcttctaccttcccctccgaagggaaaattcgaattggaatcgacctttcaaggaatg
ggatttggctatgatagcaaagctaaagaatacaaggttgtgaaaattatagaaaattgtgagtattcagatgctgagcg
aacattttctcatcgtattgctcttcctcacacggctgaggtatatgtcacgactactaactcttggagagtgatcgaga
ttgaaatatcaagtgatacctataactgttcttgttcagtatgcttgaagggattttgttattggtttgcaagcgatgac
gaggaatacatactttcatttgatttaggtgaggagatatttcatagaatacaactgccttgtaggaaagaatccggttt
tttgttttatgatctttttctgtataatgaatccatcgc
back to top
>KC701677.1-SFBB2679
accgttctcagatgcccgttttcccggacagaagttggaaacgagaatatttctggtccatgattaatctttcccatgat
agtgatgagcacaacctttattatgatgttgagggcctaaatatacaatttccattggaagatcatgatcatgtatcgat
tcatggctattgcaatgggattgtctgtctaatagtagggaaaaatgctgttttatacaatcctgcaacgagggaactga
agcaactacctgattcatgccttcttctaccttcccctcaggagggaaaattcgaattggaatcgacctttcaaggaatg
ggatttggctttgatagcaaagctaaagaatacaaggttgtgaaaattatagaaaattgtgagtattcagatgatatgcg
aacattttctcatcgtattgctcttcctcacacggctgaggtatatgtcacaactactaactcttggagagtgatcgaga
ttgaaatatcaagtgatacctataactgttcttgttcagtatacttaaaggaattttgttattggtttgcaagcgatgac
gaggaatacatcctttcatttgatttaggtgatgagatatttcatagaatacaattgccttataggaaagaatccggttt
tttgttttatgatctttttctgtataatgaatccatcgc
back to top
>KC701647.1-SFBB2.m1843
aaatgtatacgcaagtcttggtgcacggtcatcaacaatccaagttttatggccaaacacctcagcaattccgttgacaa
caaattctcatcctccacttgtatccttctccatcgttctcagatgcccgttttcccggacagaagttggaaacgagaat
atttctggtccatgattaatctttcccatgatagtgatgagcacaacctttattatgatgttgaagacctaaatatacaa
tttccattggaagatcatgatcatgtatcgattcatggctattgcaatgggattgtctgtctaatagtagggaaaaatgc
tgttttatacaatcctgcaacgagggaactgaagcacctacctgattcatgccttcttctaccttcccctccggagggaa
agttcgaattggaatcgacctttcaaggaatgggatttggctatgatagcaaagctaaagaatacaaggttgtgaaaatt
atagaaaattgtgagtattcagatgatatgcgaacattttctcatcgtattgctcttcctcacacggctgaggtatatgt
cacaactactaactcttggagagtgatcgagattgaaatatcaagtgatacctataactgttcttgttcagtatacttga
agggattttgttattggtttgcaagcgatgacgaggaatacatactttcatttgatttaggtgatgagatatttcataga
atacaattgccttataggaaagaatccgcttttttgttttatgatctttttttgtataatgaatctatcgcttctttttg
ctctcattgtgataaaagtgacaattctggaatattggaaata
back to top
>KC701646.1-SFBB2.m1843
aaatgtatacgcaagtcttggtgcacggtcatcaacaatccaagttttatggccaaacacctcagcaattccgttgacaa
caaattctcatcctctacttgtatccttctccatcgttctcataagcctgttttcccggacagaagttggaaacgagaat
atttctggtccatgattaatctttcccatgatagtgatgagcacaacctttattatgatgttgaggacctaaatatacaa
tttccattggaagatcatgatcttgtatcagttcatggctattgcaatgggattgtctgtctaatagtagggaaaaatgc
tgttttatacaatcctgcaacgagggaactgaagaaactacctgattcatgccttcttctaccttcccctcagaagggaa
aattcgaattggaatcgacctttcaaggaatgggatttggctatgatagcaaagctaaagaatacaaggttgtgaaaatt
atagaaaattgtgagtattcagatgatgagcgaacattttctcatcgtattgctctttgtcacacggctgaggtatatgt
tacgactactaactcttggagagtgatcgagattgaaatatcaagtgatacctataactgttcttgttcagtatacttga
agggattttgttattggtttgcaagcgatgacgaggaatacatactttcatttgatttaggtgatgagatatttcataga
atacaattgccttataggaaagaatccggttttttgttttatgatctttttttatataatgaatctatcgcatctttttg
ctctcattatgataaaagtgacaactctggaatattggaaata
back to top
>KC701637.1-SFBB2.m1843
aaatgtatacgcaagtcttggtgcacggtcatcaacaatccaagttttatggccaaacacctcagcaattccgttgacaa
caaattctcatcctccacttgtatccttctccatcgttctcagatgcccgttttcccggacagaagttggaaacgagaat
atttctggtccatgattaatctttcccatgatagtgatgagcacaacctttattatgatgttgaagacctaaatatacaa
tttccattggaagatcatgatcatgtatcgattcatggctattgcaatgggattgtctgtctaatagtagggaaaaatgc
tgttttatacaatcctgcaacgagggaactgaagcacctacctgattcatgccttcttctaccttcccctccggagggaa
agttcgaattggaatcgacctttcaaggaatgggatttggctatgatagcaaagctaaagaatacaaggttgtgaaaatt
atagaaaattgtgagtattcagatgatatgcgaacattttctcatcgtattgctcttcctcacacggctgaggtatatgt
cacaactactaactcttggagagtgatcgagattgaaatatcaagtgatacctataactgttcttgttcagtatacttga
agggattttgttattggtttgcaagcgatgacgaggaatacatactttcatttgatttaggtgatgagatatttcataga
atacaattgccttataggaaagaatccgcttttttgttttatgatctttttttgtataatgaatctatcgcttctttttg
ctctcattgtgataaaagtgacaattctggaatattggaaata
back to top
>KC701636.1-SFBB2.m1846
acatgtttacgcaagtcttggtgcacggtcatcaacaatccaagttttatggccaaacacctcagcaattccgttgacaa
caaattctcatcctccacttgtatccttctccaccgttctcagatgcccgttttcccggacagaagttggaaacgagaat
atttctggtccatgattaatctttcccatgatagtgatgagcacaacctttattatgatgttgaggacctaaatatacaa
tttccattggaagatcatgatcatgcatcgattcatggctattgcaatgggattgtctgtctaatagtagggaaaaatgc
tgttttatacaatcctgcaacgagggaactgaagcaactacctgattcatgccttcttctaccttcccctccggagggaa
aattcgaattggaatcgacctttcaaggaatgggatttggctatgatagcaaagctaaagaatacaaggttgtgaaaatt
atagaaaattgtgagtattcagatgatatgcgaacattttcccatcgtattgctcttcctcacacggctgaggtatatgt
cacgactactaactcttggagagtgatcgagattgaaatatcaagtgatacctataattgttcttgttcagtatacttga
agggattttgttattggtttgcaagcgatgacgaggaatacatactttcatttgatttaggtgatgagatatttcataga
atacaattgccttataggaaagaatccggttttttgttttatgatctttttctgtataatgaatccatcgcttctttttg
ctctcattatgataaaagtgacaattctggaatgttggaaatactt
back to top
>KC701678.1-SFBB2.m1679
atcgttctcatatgcctgttttcccggacagaagttggaaacgagaatatttctggtccatgattaatctttcccatgat
agtgatgagcacaacctttattatgatgttgaggacctaaatatacaatttccattggaagatcatgatcttgtatcaat
tcatggctattgcaatgggattatctgtctaatagtagggaaaaatgctattttatacaatcctgcaacgagggaactga
agcaactacctgattcatgccttcttctaccttcccctccgaagggaaaattcgaattggaatcgacctttcaaggaatg
ggatttggctatgatagcaaagctaaagaatacaaggttgtgaaaattatagaaaattgtgagtattcagatgctgagcg
aacattttctcatcgtattgctcttcctcacacggctgaggtatatgtcacgactactaactcttggagagtgatcgaga
ttgaaatatcaagtgatacctataactgttcttgttcagtatgcttgaagggattttgttattggtttgcaagcgatgac
gaggaatacatactttcatttgatttaggtgaggagatatttcatagaatacaactgccttgtaggaaagaatccggttt
tttgttttatgatctttttctgtataatgaatccatcgc
back to top
>KC701677.1-SFBB2.m1679
accgttctcagatgcccgttttcccggacagaagttggaaacgagaatatttctggtccatgattaatctttcccatgat
agtgatgagcacaacctttattatgatgttgagggcctaaatatacaatttccattggaagatcatgatcatgtatcgat
tcatggctattgcaatgggattgtctgtctaatagtagggaaaaatgctgttttatacaatcctgcaacgagggaactga
agcaactacctgattcatgccttcttctaccttcccctcaggagggaaaattcgaattggaatcgacctttcaaggaatg
ggatttggctttgatagcaaagctaaagaatacaaggttgtgaaaattatagaaaattgtgagtattcagatgatatgcg
aacattttctcatcgtattgctcttcctcacacggctgaggtatatgtcacaactactaactcttggagagtgatcgaga
ttgaaatatcaagtgatacctataactgttcttgttcagtatacttaaaggaattttgttattggtttgcaagcgatgac
gaggaatacatcctttcatttgatttaggtgatgagatatttcatagaatacaattgccttataggaaagaatccggttt
tttgttttatgatctttttctgtataatgaatccatcgc
back to top