SFBB3-alpha, SFBB3-alpha (gene) Malus x domestica

Gene Overview
Name SFBB3-alpha
Gene Symbol SFBB3-alpha
Type gene
Organism Malus x domestica
Synonym MdSFBB3-alpha
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB3-alphaAB270795.1-SFBB3-alphaMalus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB3-alphaAB270795.1-SFBB3-alpha.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AB270795.1-SFBB3-alpha Chr17:31155580..31156765
unanchored:75400665..75401852
AB270795.1
predicted genes from whole genome assembly AB270795.1-SFBB3-alpha.m1 Chr17:31155580..31156765
unanchored:75400665..75401852
AB270795.1

Sequence(s):
>AB270795.1-SFBB3-alpha1185
atgtcccatgtgcgtgaaagtgaaactcctgaagatagggtagttgaaatcttatccaggttaccgcccaagtctctgat
gcggttcaaatgcatacacaagtcttggttctctctcatcaacaatctaagttttgtggccaaacacctcagcaattccg
tggacaacaaactctcatcctccacttgtatccttctcaaccgttctcaggctcacattttcccagaccagagttggaaa
caagaagttttctggtccatgattaatttttccattgatagtgatgagaacaaccttcattacgatgttgaggacctaaa
tataccgtttgcattgaaagatcatgattttgtactgatttttggttattgcaatgggatactctgtgtagaagctggga
aaaatgttcttttatgcaatcctgcaacgagggaattcaagcaacttcccgattcatgccttcttctaccttcccctcct
gagagaaaattcgaattggaaactaactttcaagctttgggatttggatatgattgcaatgctaaagaatacaaggttgt
gcgaattatagaaaattgtgagtattcagatgatgaacgaacatattattatcgtattgctcttcctcacacggctgagt
tatacaccacaactgctaattcttggaaagagatcaagattgatatatcaagtacaacctattcttgttctcgttcagtg
ttcatgaagggattttgttattggtatgcaacagatggcgaggaatacatactttcttttgatttaggtgatgacacatt
tcatataatacaactgccttctaggagagaatccggttttaggttttattatatttttctacgaaatgaatcccttgctt
ctttttgctctcgttatgataggagtgaggattctgaatcatgtgaaatatgggtaatggatgactatgacggtgataaa
agttcatggacaaaacttttaaacattggacccttacaaggcattaagaagcccctgacattttggagaagtgatgagct
tcttatgcttgattccgatggaagagccacctcttataattatagtactagaaatctcaagtatcttcatattcctccta
ttctcaatagggttgtggattttgaagttcttatttatgtgaaaagtattgttcatgtcaagtga
back to top
>AB270795.1-SFBB3-alpha.m11185
atgtcccatgtgcgtgaaagtgaaactcctgaagatagggtagttgaaatcttatccaggttaccgcccaagtctctgat
gcggttcaaatgcatacacaagtcttggttctctctcatcaacaatctaagttttgtggccaaacacctcagcaattccg
tggacaacaaactctcatcctccacttgtatccttctcaaccgttctcaggctcacattttcccagaccagagttggaaa
caagaagttttctggtccatgattaatttttccattgatagtgatgagaacaaccttcattacgatgttgaggacctaaa
tataccgtttgcattgaaagatcatgattttgtactgatttttggttattgcaatgggatactctgtgtagaagctggga
aaaatgttcttttatgcaatcctgcaacgagggaattcaagcaacttcccgattcatgccttcttctaccttcccctcct
gagagaaaattcgaattggaaactaactttcaagctttgggatttggatatgattgcaatgctaaagaatacaaggttgt
gcgaattatagaaaattgtgagtattcagatgatgaacgaacatattattatcgtattgctcttcctcacacggctgagt
tatacaccacaactgctaattcttggaaagagatcaagattgatatatcaagtacaacctattcttgttctcgttcagtg
ttcatgaagggattttgttattggtatgcaacagatggcgaggaatacatactttcttttgatttaggtgatgacacatt
tcatataatacaactgccttctaggagagaatccggttttaggttttattatatttttctacgaaatgaatcccttgctt
ctttttgctctcgttatgataggagtgaggattctgaatcatgtgaaatatgggtaatggatgactatgacggtgataaa
agttcatggacaaaacttttaaacattggacccttacaaggcattaagaagcccctgacattttggagaagtgatgagct
tcttatgcttgattccgatggaagagccacctcttataattatagtactagaaatctcaagtatcttcatattcctccta
ttctcaatagggttgtggattttgaagttcttatttatgtgaaaagtattgttcatgtcaagtga
back to top