SFBB3-beta, SFBB3-beta (gene) Malus x domestica

Gene Overview
Name SFBB3-beta
Gene Symbol SFBB3-beta
Type gene
Organism Malus x domestica
Synonym MdSFBB3-beta
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB3-betaAB270796.1-SFBB3-betaMalus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB3-betaAB270796.1-SFBB3-beta.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AB270796.1-SFBB3-beta Chr17:31359749..31360931
chr16:20506661..20507844
chr16:23099397..23100580
AB270796.1
predicted genes from whole genome assembly AB270796.1-SFBB3-beta.m1 Chr17:31359749..31360931
chr16:20506661..20507844
chr16:23099397..23100580
AB270796.1

Sequence(s):
>AB270796.1-SFBB3-beta1182
atgtcccaggtgcatgaaagtgaaactcctgaagataaggtggtcgaaatcctgtgtaggttgccacccaagtctctgat
gcgattcaaatgcatacggaagtcttggtgcactctcatcaatagaccaagttttgtggccaaacaccttaacaattctg
tggacaacaaactctcatcctccacttgtatccttctcaaccgttctcaggctcacattttcccggaccagagttggaaa
caagaagttttctggtccacgattaatctttccattgatagtgatgaacacaaccttcattatgatgttgaggacctaat
tataccgtttccattggaagatcatgattttgtactgattttcggttattgcaatgggattgtctgtgtagatgcaggga
aaaatgttcttttatgcaatcctgcaacgagagaatttaggcaacttccggattcatgccttcttcaaccccctcccaag
ggaaaatttgaattggaaacgacttttcaagcattaggatttggctatgattgcaatgctaaagaatacaaggttgtgcg
aattgtggaaaattgtgagtattcagatgatgagcaaacattttatcatcgtatagcacttcctcacacagctgaggtat
ataccacggctgctaacttttggaaagagatcaagattgatatatcaattaaaacctatcattgttcttgttcagtgtac
ttgaagggattttgttattggtttgcaagcgataacgaggaatacatacttgcattttatttaggtgatgagacatttca
tataatacaattgccttctaggagagaatccggttttacgtttgattatatttttctgcgaaatgaatcccttgcttctt
tttgctctccctataatccaagtgaggattctaaattatttgaaatatgggtaatggacgactatgatggagttagcagt
tcatggacaaaactcctaactgttggaccctttaaaggcgttgagtatcctttgacactttggaaatgtgatgagcttct
tatgcttgcatccgatggaagggctacctcttataattctagtaccggaaatcttaagtatcttcatattcctcctattc
tcaataaggttgtggattttgaaggtcttatttatgtgaaaagtattgttccactcaagtga
back to top
>AB270796.1-SFBB3-beta.m11182
atgtcccaggtgcatgaaagtgaaactcctgaagataaggtggtcgaaatcctgtgtaggttgccacccaagtctctgat
gcgattcaaatgcatacggaagtcttggtgcactctcatcaatagaccaagttttgtggccaaacaccttaacaattctg
tggacaacaaactctcatcctccacttgtatccttctcaaccgttctcaggctcacattttcccggaccagagttggaaa
caagaagttttctggtccacgattaatctttccattgatagtgatgaacacaaccttcattatgatgttgaggacctaat
tataccgtttccattggaagatcatgattttgtactgattttcggttattgcaatgggattgtctgtgtagatgcaggga
aaaatgttcttttatgcaatcctgcaacgagagaatttaggcaacttccggattcatgccttcttcaaccccctcccaag
ggaaaatttgaattggaaacgacttttcaagcattaggatttggctatgattgcaatgctaaagaatacaaggttgtgcg
aattgtggaaaattgtgagtattcagatgatgagcaaacattttatcatcgtatagcacttcctcacacagctgaggtat
ataccacggctgctaacttttggaaagagatcaagattgatatatcaattaaaacctatcattgttcttgttcagtgtac
ttgaagggattttgttattggtttgcaagcgataacgaggaatacatacttgcattttatttaggtgatgagacatttca
tataatacaattgccttctaggagagaatccggttttacgtttgattatatttttctgcgaaatgaatcccttgcttctt
tttgctctccctataatccaagtgaggattctaaattatttgaaatatgggtaatggacgactatgatggagttagcagt
tcatggacaaaactcctaactgttggaccctttaaaggcgttgagtatcctttgacactttggaaatgtgatgagcttct
tatgcttgcatccgatggaagggctacctcttataattctagtaccggaaatcttaagtatcttcatattcctcctattc
tcaataaggttgtggattttgaaggtcttatttatgtgaaaagtattgttccactcaagtga
back to top