SFBB31-gamma, SFBB31-gamma (gene) Malus x domestica

Gene Overview
Name SFBB31-gamma
Gene Symbol SFBB31-gamma
Type gene
Organism Malus x domestica
Synonym SFBBgamma protein
Description NA
Comment S-locus F-box brother protein; SFBBgamma-McInt2
S-locus F-box brother protein; SFBBgamma-McInt1
S-locus F-box brother protein; SFBBgamma-Fuji1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB31-gammaHM013921.1-SFBB31-gamma.m1Malus x domesticamRNA
SFBB31-gammaHM013920.1-SFBB31-gamma.m1Malus x domesticamRNA
SFBB31-gammaHM013904.1-SFBB31-gamma.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HM013921.1-SFBB31-gamma.m1 N/A HM013921.1
mRNA parsed from NCBI nr database HM013920.1-SFBB31-gamma.m1 N/A HM013920.1
mRNA parsed from NCBI nr database HM013904.1-SFBB31-gamma.m1 N/A HM013904.1

Sequence(s):
>HM013921.1-SFBB31-gamma.m11187
atgtcccaggtgcgtgaaagtgaaactcctgaagataggatggtcgaaatcttgtccaggttgccacccaagtctttgat
gcgtttcaaatgcatacgcaaatcttggtgcgctcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaagagagttggaaa
caagaagttttatggtccgtgattaatctttccattgatggtgacgagcttcattatgatattgagggcctaactaatgt
accgtttctaaaggatgaccatcctgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatattgagcatattgctcttcctcacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatattaagtaaaatattatcatcatatagc
gaaccatattcttgttcagtgtttttgaaagggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggggaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcactagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacatctaactgctggaccttttaaagacatggagtttccattgacaccttg
gaaatgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatgagaatagggttgtagattacgtgaaaagtattagtctagtcaa
back to top
>HM013920.1-SFBB31-gamma.m11187
atgtcccaggtgcgtgaaagtgaaactcctgaagataggatggtcgaaatcttgtccaggttgccacccaagtctttgat
gcgtttcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaagagagttggaaa
caagaagttttatggtccgtgattaatctttccattgatggtgacgagcttcattatgatattgagggcctaactaatgt
accgtttctaaaggatgaccatcctgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttcctcacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatattaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtttttgaaagggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggggaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcactagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacatctaactgctggaccttttaaagacatggagtttccattgacaccttg
gaaatgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatgagaatagggttgtagattacgtgaaaagtattagtctagtcaa
back to top
>HM013904.1-SFBB31-gamma.m11187
atgtcccaggtgcgtgaaagtgaaactcctgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtagccaaacacctcagcgattcag
tggacaacaaactctcatcctccacttgtatccttctcaactgttctaaggctcacgtttgctcggaagagagttggaaa
caaggagttttatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatgt
accgtttctaagggatgaccaacatgaattagagattcacggttattgcgatgggattatttgtgtaacggtaaacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggtgta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttcctcacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatattaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaagggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgctctagttacgaagagccttccacattatttgaaatatgggtcatggattac
aatgacggatttaagagtccatggacaaaacacttaactgctggaccttttaaagacatggagtttccattgacaccttg
gaaacgtaacgagcttcttatgattacctccgatggaagagttgcttcttataattcttgtagcggaaatttcaagtatc
ttcatattcctgttattattaatgagaatagggttgtagattacgtgaaaagtattattctagtcaa
back to top