SFBB31-gamma, SFBB31-gamma (gene) Pyrus communis

Gene Overview
Name SFBB31-gamma
Gene Symbol SFBB31-gamma
Type gene
Organism Pyrus communis
Synonym SFBBgamma protein
Description NA
Comment S-locus F-box brother protein; SFBBgamma-Wild2
S-locus F-box brother protein; SFBBgamma-Cons2
S-locus F-box brother protein; SFBBgamma-Cons1
S-locus F-box brother protein; SFBBgamma-MRB2
S-locus F-box brother protein; SFBBgamma-MRB1
S-locus F-box brother protein; SFBBgamma-AF2
S-locus F-box brother protein; SFBBgamma-AF1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB31-gammaHM013929.1-SFBB31-gamma.m1Pyrus communismRNA
SFBB31-gammaHM013894.1-SFBB31-gamma.m1Pyrus communismRNA
SFBB31-gammaHM013893.1-SFBB31-gamma.m1Pyrus communismRNA
SFBB31-gammaHM013882.1-SFBB31-gamma.m1Pyrus communismRNA
SFBB31-gammaHM013881.1-SFBB31-gamma.m1Pyrus communismRNA
SFBB31-gammaHM013875.1-SFBB31-gamma.m1Pyrus communismRNA
SFBB31-gammaHM013874.1-SFBB31-gamma.m1Pyrus communismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus communisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HM013929.1-SFBB31-gamma.m1 scaffold01086:55112..56299
HM013929.1
mRNA parsed from NCBI nr database HM013894.1-SFBB31-gamma.m1 scaffold01086:55112..56299
HM013894.1
mRNA parsed from NCBI nr database HM013893.1-SFBB31-gamma.m1 scaffold01086:55112..56299
HM013893.1
mRNA parsed from NCBI nr database HM013882.1-SFBB31-gamma.m1 scaffold01086:55112..56299
HM013882.1
mRNA parsed from NCBI nr database HM013881.1-SFBB31-gamma.m1 scaffold01086:55112..56299
HM013881.1
mRNA parsed from NCBI nr database HM013875.1-SFBB31-gamma.m1 scaffold01086:55112..56299
HM013875.1
mRNA parsed from NCBI nr database HM013874.1-SFBB31-gamma.m1 N/A HM013874.1

Sequence(s):
>HM013929.1-SFBB31-gamma.m11187
atgtcccaggtgcgtgaaagtgaaactcctgaagataggatagtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacatctcagcgactctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaaaagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatgaccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatataccaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcgtattcctgttattattaatcagaatagggttgtagattacgtgaaaactattattctagtcaa
back to top
>HM013894.1-SFBB31-gamma.m11187
atgtcccaggtgcgtgaaagtgaaactcctgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaagagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatgt
accgcttctaaaggatgaccctcatgaagttgagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatatggagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagacatggagtttccattgacaccttg
gaaatgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagagttgtagattacgtgaaaagtattattctagtcaa
back to top
>HM013893.1-SFBB31-gamma.m11187
atgtcccaggtgcgtgaaagtgaaactcctgaagataggatagtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacatctccgcgactctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaagagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatgt
accgcttctaaaggatgaccctcatgaagttgagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatataccaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagagttgtagattacgtgaaaagtattattctagtcaa
back to top
>HM013882.1-SFBB31-gamma.m11187
atgtcccaggtgcgtgaaagtgaaactcctgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacatctcagcgactctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaagagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatgt
accgcttctaaaggatgaccctcatgaagttgagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgcttgatataccaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcgtattcctgttattattaatcagaatagggttgtagattacgtgaaaactattattctagtcaa
back to top
>HM013881.1-SFBB31-gamma.m11187
atgtcccaggtgcgtgaaagtgaaactcctgaagataggatggtcgaaatcttgtccaggttgccgcccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacatctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaagagagttggaaa
caagaagtttcatggtccgtgattaatatttccattgatggtgatgagcttcattatgatattgaggacctaactaatgt
accgcttctaaaggatgaccctcatgaagttgagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatatggagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgatggatctaagagtttatggacaaaacacctaactgctggaccttttaatgatatggagtttccattgacaccttg
gaaatgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagggttgtagattacgtgaaaagtattattctagtcaa
back to top
>HM013875.1-SFBB31-gamma.m11187
atgtcccaggtgcgtgaaagtgaaactcccgaagataggatggtcgaaatcttgtccaggttaccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacatctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaacagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactactgt
accgtttctaaaggatgaccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
attcctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatatggagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaatttggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagggttgtagattatgtgaaaagtattattctagtcaa
back to top
>HM013874.1-SFBB31-gamma.m11187
atgtcccaggtgcgtgaaagtgaaactcctgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaaaagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatgaccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatgactactaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaagggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttatctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcactagttacgaagagccttccacattatttgaaatatgggtaatggactac
gatgatggatttaagagttcatggacaaaacacctaactgctggaccttttaaagacatggactttccattgacacattg
gaaacgtgacgagtttcttatgattgcttcagatggaagagttgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatgagaatagggttgtagattacgtgaaaagtattgttttagtcaa
back to top