SFBB31-gamma, SFBB31-gamma (gene) Pyrus pyrifolia

Gene Overview
Name SFBB31-gamma
Gene Symbol SFBB31-gamma
Type gene
Organism Pyrus pyrifolia
Synonym SFBBgamma protein
SFBB31-gamma
Description NA
Comment S-locus F-box brother protein; SFBBgamma-Kum2
S-locus F-box brother protein; SFBBgamma-Kum1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB31-gammaHM013912.1-SFBB31-gamma.m1Pyrus pyrifoliamRNA
SFBB31-gammaHM013911.1-SFBB31-gamma.m1Pyrus pyrifoliamRNA
SFBB31-gammaEU422959.1-SFBB31-gamma.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HM013912.1-SFBB31-gamma.m1 scaffold01086:55112..56299
HM013912.1
mRNA parsed from NCBI nr database HM013911.1-SFBB31-gamma.m1 scaffold01086:55112..56299
HM013911.1
mRNA parsed from NCBI nr database EU422959.1-SFBB31-gamma.m1 scaffold01086:55112..56303
EU422959.1

Sequence(s):
>HM013912.1-SFBB31-gamma.m11187
atgtcccaggtgcgtgaaagtgaaactcctgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacatctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcatgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttc
tgtataatgaatccctcacttattattgcagtagttacgaagagccttccacattatttgagatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaatgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagggttgtagattacgtgaaaagtattattctagtcaa
back to top
>HM013911.1-SFBB31-gamma.m11187
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtcgaggaatatatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaaacgtgatggtatttttc
tgtacaatgaatccctcacttattattgcagtagttatgaagagccttccacattatttgagatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagggttgtagattacgtgaaaagtattattctagtcaa
back to top
>EU422959.1-SFBB31-gamma.m11191
atgtcccaggtgcgtgaaggtgaaactcctgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcgctcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaaacgtgatggtatttttc
tgtacaatgaatccctcacttattattgcagtagttatgaagagccttccacattatttgagatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatgtggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagggttgtagattacgtgaaaagtattattctagtcaattga
back to top