SFBB3, SFBB3 (gene) Sorbus aucuparia

Gene Overview
Name SFBB3
Gene Symbol SFBB3
Type gene
Organism Sorbus aucuparia
Synonym SFBB3
Description NA
Comment allele linked with S22-RNase
allele linked with Sa-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB3KC701682.1-SFBB3Sorbus aucupariagene
SFBB3KC701681.1-SFBB3Sorbus aucupariagene
SFBB3KC701680.1-SFBB3Sorbus aucupariagene
SFBB3KC701679.1-SFBB3Sorbus aucupariagene
SFBB3KC701641.1-SFBB3Sorbus aucupariagene
SFBB3KC701628.1-SFBB3Sorbus aucupariagene
SFBB3KC701625.1-SFBB3Sorbus aucupariagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB3KC701682.1-SFBB3.m1Sorbus aucupariamRNA
SFBB3KC701681.1-SFBB3.m1Sorbus aucupariamRNA
SFBB3KC701680.1-SFBB3.m1Sorbus aucupariamRNA
SFBB3KC701679.1-SFBB3.m1Sorbus aucupariamRNA
SFBB3KC701641.1-SFBB3.m1Sorbus aucupariamRNA
SFBB3KC701628.1-SFBB3.m1Sorbus aucupariamRNA
SFBB3KC701625.1-SFBB3.m1Sorbus aucupariamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBSorbus aucupariagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KC701682.1-SFBB3 N/A KC701682.1
gene parsed from NCBI nr database KC701681.1-SFBB3 N/A KC701681.1
gene parsed from NCBI nr database KC701680.1-SFBB3 N/A KC701680.1
gene parsed from NCBI nr database KC701679.1-SFBB3 N/A KC701679.1
gene parsed from NCBI nr database KC701641.1-SFBB3 N/A KC701641.1
gene parsed from NCBI nr database KC701628.1-SFBB3 N/A KC701628.1
gene parsed from NCBI nr database KC701625.1-SFBB3 N/A KC701625.1
mRNA parsed from NCBI nr database KC701682.1-SFBB3.m1 N/A KC701682.1
mRNA parsed from NCBI nr database KC701681.1-SFBB3.m1 N/A KC701681.1
mRNA parsed from NCBI nr database KC701680.1-SFBB3.m1 N/A KC701680.1
mRNA parsed from NCBI nr database KC701679.1-SFBB3.m1 N/A KC701679.1
mRNA parsed from NCBI nr database KC701641.1-SFBB3.m1 N/A KC701641.1
mRNA parsed from NCBI nr database KC701628.1-SFBB3.m1 N/A KC701628.1
mRNA parsed from NCBI nr database KC701625.1-SFBB3.m1 N/A KC701625.1

Sequence(s):
>KC701682.1-SFBB3552
ttcacattttcccggatcagagttggaaacgtgaggttttatggtccatgattaatctttccattaatagtgatgtgcac
aaccttcattatgatgttaagcccttaaatataccgttttctagggatgaccataatcctgtacagattcacgggtattg
caatgggattgtatgtctaatagaaggggataatgttcttctatgcaatccttcaacgagggaattcaggttacttccca
attcatgccttcttgtaccccatcccgagggaaaattcgaattggaaacgacctttcacggaatgggttttggctatgat
tgcaaagctaacgaatacaaggttgtgcaaattgtagaaaattgtgagtattcagatgatgagcaaacatatcaacattg
tattgcttatccatacacggctgaggtatacaccacggctactaacttttggaaagagatcaagattgatatatcaagtt
caatccatccctatcccttttctgtgtacttgaagggattttgttattggtttgcaacggacggcgaagaat
back to top
>KC701681.1-SFBB3552
ttcacattttcccggatcagagttggaaacgtgaggttttatggtccatgattaatctttccattaatagtgatgtgcac
agccttcattatgatgttaagcccttaaatataccgttttctagggatgaccataatcctgtacagattcacgggtattg
caatgggattgtatgtctaatagaaggcgataatgttcttctatgcaatccttcaacgagggaattcaggctacttccca
attcatgccttcttgtaccccatcccgagggaaaattcgaattggaaacgacctttcacggaatgagttttggctatgat
tgcaaagctaatgaatacaaggttgtgcaaattgtagaaaattgtgagtattcagatgatgagcaaacatatcaacattg
tattgcttatccatacacggctgaggtatacaccacggctactaacttttggaaagagatcaagattgatatatcaagtt
caatccatccctatcccttttctgtgtacttgaagggattttgttattggtttgcaacggacggcgaagaat
back to top
>KC701680.1-SFBB3552
ttcacattttcccggatcagagttggaaacgtgaggttttatggtccatgattaatctttccattaatagtgatgtgcac
aaccttcattatgatgttaagcccttaaatataccgttttctagggatgaccataatcctgtacagattcacgggtattg
caatgggattgtatgtctaatagaaggggataatgttcttctatgcaatccttcaacgagggaattcaggctacttccca
attcatgccttcttgtaccccatcccgagggaaaattcgaattggaaacgacctttcacggaatgggttttggctatgat
tgcaaagctaatgaatacaaggttgtgcaaattatagaaaattgtgagtattcagatgatgagcaaacatatcaacattg
tattgcttatccatacacggctgaggtatacaccacggctactaacttttggaaggagatcaagattgatatatcaagtt
caatccatccctatcccttttctgtgtacttgaagggattttgttattggtttgcaacggacggcgaagaat
back to top
>KC701679.1-SFBB3552
ttcacattttcccggatcagagttggaaacgtgaagttttatggtccatgattaatctttcgattgatagtgatgtgcac
aaccttcattatgatgttaagcccttaaatataccgttttctagggatgaccataatcctgtacagattcacgggtattg
caatgggattgtatgtctaatagaaggggataatgttcttctatgcaatccttcaacgagggaattcaggctacttccca
attcatgccttcttgtaccccatcccgagggaaaattcgaattggaaacgacctttcacggaatgggttttggctatgat
tgcaaagctaatgaatacaaggttgtgcaaattgtagaaaattgtgagtattcagatgatgagcaaacatatcaacattg
tattgcttatccatacacggctgaggtatacaccacggctgctaacttttggaaagagatcaagattgatatatcaagtt
caacccatccctatcccttttctgtgtacttgaagggattttgttattggtttgcaacggatggcgaagaat
back to top
>KC701641.1-SFBB3834
aaatgcatacgcaagtcttggtgcactctgatcaatagtccaagttttgtggccaaacacctcagcaattccttggacaa
caaactctcatcctccacttgtatccttctcaaccgttctcagtttcacattttcccggatcagagttggaaacgtgaag
ttttatggtccatgattaatctttcgattgatagtgatgtgcacaaccttcattatgatgttaagcccttaaatataccg
ttttctagggatgaccataatcctgtacagattcacgggtattgcaatgggattgtatgtctaatagaaggggataatgt
tcttctatgcaatccttcaacgagggaattcaggctacttcccaattcatgccttcttgtaccccatcccgagggaaaat
tcgaattggaaacgacctttcacggaatgggttttggctatgattgcaaagctaatgaatacaaggttgtgcaaattgta
gaaaattgtgagtattcagatgatgagcaaacatatcaacattgtattgcttatccatacacggctgaggtatacaccac
ggctgctaacttttggaaagagatcaagattgatatatcaagttcaacccatccctatcccttttctgtgtacttgaagg
gattttgttattggtttgcaacggatggcgaagaatgcatactttcatttgatttaggtgatgagatatttcatagaata
caattgccttctaagatagaatccagttttaacttttgtggtctttttctttataatgaatctatcacttcttattgttg
tcgttatgatccaagtgaggattctaaattattt
back to top
>KC701628.1-SFBB3834
aaatgcatatgcaagtcttggtgcactctcatcaatagtccaagttttgtggccaaacacctcagcaattccttggacaa
caaactcttatcctccacttgtatccttctcaaccgttctcagtttcacattttcccggatcagagttggaaacgtgaag
ttttatggtccatgattaatctttccattgatagtgatgtgcacaaccttcattatgatgttaagcccttgaatataccg
tttcctagggatgaccataatcctatagagattcacggttattgcaatgggattgtatgtctaatagaaggggataatgt
tcttctgtgcaatccttcaacgagggaattcaggctacttcccaattcatgccttcttgtaccccatcccgagggaaaat
tcgaattggaaacgacctttcacggaatgggttttggctacgattgcaaagctaaagaatacaaggttgtgcaaattata
gaaaattgtgagtattcagatgatgagcaaacatatcaacatcgtattgcttatccttacacggctgaggtatacaccac
ggctgctaacttttggaaagagatcaagattaatatatcaagtacaatccatccctatcctttttctgtgtacttgaagg
gattttgttattggtttgcaacagatggcgaggaatgcatactttcatttgatttaggtgatgagatatttcatagaata
caattgccttctaagatagaatccggttttgagttttgtggtctttttctttataatgaatctatcacttcttattgttg
tcataacgatccaagtgaggattctaaattattt
back to top
>KC701625.1-SFBB3834
aaatgcatacgcaagtcttggtgcactctgatcaatagtccaagttttgtggccaaacacctcagcaattccttggacaa
caaactctcatcctccacttgtatccttctcaaccgttctcagtttcacattttcccggatcagagttggaaacgtgaag
ttttatggtccatgattaatctttcgattgatagtgatgtgcacaaccttcattatgatgttaagcccttaaatataccg
ttttctagggatgaccataatcctgtacagattcacgggtattgcaatgggattgtatgtctaatagaaggggataatgt
tcttctatgcaatccttcaacgagggaattcaggctacttcccaattcatgccttcttgtaccccatcccgagggaaaat
tcgaattggaaacgacctttcacggaatgggttttggctatgattgcaaagctaatgaatacaaggttgtgcaaattgta
gaaaattgtgagtattcagatgatgagcaaacatatcaacattgtattgcttatccatacacggctgaggtatacaccac
ggctgctaacttttggaaagagatcaagattgatatatcaagttcaacccatccctatcccttttctgtgtacttgaagg
gattttgttattggtttgcaacggatggcgaagaatgcatactttcatttgatttaggtgatgagatatttcatagaata
caattgccttctaagatagaatccagttttaacttttgtggtctttttctttataatgaatctatcacttcttattgttg
tcgttatgatccaagtgaggattctaaattattt
back to top
>KC701682.1-SFBB3.m1552
ttcacattttcccggatcagagttggaaacgtgaggttttatggtccatgattaatctttccattaatagtgatgtgcac
aaccttcattatgatgttaagcccttaaatataccgttttctagggatgaccataatcctgtacagattcacgggtattg
caatgggattgtatgtctaatagaaggggataatgttcttctatgcaatccttcaacgagggaattcaggttacttccca
attcatgccttcttgtaccccatcccgagggaaaattcgaattggaaacgacctttcacggaatgggttttggctatgat
tgcaaagctaacgaatacaaggttgtgcaaattgtagaaaattgtgagtattcagatgatgagcaaacatatcaacattg
tattgcttatccatacacggctgaggtatacaccacggctactaacttttggaaagagatcaagattgatatatcaagtt
caatccatccctatcccttttctgtgtacttgaagggattttgttattggtttgcaacggacggcgaagaat
back to top
>KC701681.1-SFBB3.m1552
ttcacattttcccggatcagagttggaaacgtgaggttttatggtccatgattaatctttccattaatagtgatgtgcac
agccttcattatgatgttaagcccttaaatataccgttttctagggatgaccataatcctgtacagattcacgggtattg
caatgggattgtatgtctaatagaaggcgataatgttcttctatgcaatccttcaacgagggaattcaggctacttccca
attcatgccttcttgtaccccatcccgagggaaaattcgaattggaaacgacctttcacggaatgagttttggctatgat
tgcaaagctaatgaatacaaggttgtgcaaattgtagaaaattgtgagtattcagatgatgagcaaacatatcaacattg
tattgcttatccatacacggctgaggtatacaccacggctactaacttttggaaagagatcaagattgatatatcaagtt
caatccatccctatcccttttctgtgtacttgaagggattttgttattggtttgcaacggacggcgaagaat
back to top
>KC701680.1-SFBB3.m1552
ttcacattttcccggatcagagttggaaacgtgaggttttatggtccatgattaatctttccattaatagtgatgtgcac
aaccttcattatgatgttaagcccttaaatataccgttttctagggatgaccataatcctgtacagattcacgggtattg
caatgggattgtatgtctaatagaaggggataatgttcttctatgcaatccttcaacgagggaattcaggctacttccca
attcatgccttcttgtaccccatcccgagggaaaattcgaattggaaacgacctttcacggaatgggttttggctatgat
tgcaaagctaatgaatacaaggttgtgcaaattatagaaaattgtgagtattcagatgatgagcaaacatatcaacattg
tattgcttatccatacacggctgaggtatacaccacggctactaacttttggaaggagatcaagattgatatatcaagtt
caatccatccctatcccttttctgtgtacttgaagggattttgttattggtttgcaacggacggcgaagaat
back to top
>KC701679.1-SFBB3.m1552
ttcacattttcccggatcagagttggaaacgtgaagttttatggtccatgattaatctttcgattgatagtgatgtgcac
aaccttcattatgatgttaagcccttaaatataccgttttctagggatgaccataatcctgtacagattcacgggtattg
caatgggattgtatgtctaatagaaggggataatgttcttctatgcaatccttcaacgagggaattcaggctacttccca
attcatgccttcttgtaccccatcccgagggaaaattcgaattggaaacgacctttcacggaatgggttttggctatgat
tgcaaagctaatgaatacaaggttgtgcaaattgtagaaaattgtgagtattcagatgatgagcaaacatatcaacattg
tattgcttatccatacacggctgaggtatacaccacggctgctaacttttggaaagagatcaagattgatatatcaagtt
caacccatccctatcccttttctgtgtacttgaagggattttgttattggtttgcaacggatggcgaagaat
back to top
>KC701641.1-SFBB3.m1834
aaatgcatacgcaagtcttggtgcactctgatcaatagtccaagttttgtggccaaacacctcagcaattccttggacaa
caaactctcatcctccacttgtatccttctcaaccgttctcagtttcacattttcccggatcagagttggaaacgtgaag
ttttatggtccatgattaatctttcgattgatagtgatgtgcacaaccttcattatgatgttaagcccttaaatataccg
ttttctagggatgaccataatcctgtacagattcacgggtattgcaatgggattgtatgtctaatagaaggggataatgt
tcttctatgcaatccttcaacgagggaattcaggctacttcccaattcatgccttcttgtaccccatcccgagggaaaat
tcgaattggaaacgacctttcacggaatgggttttggctatgattgcaaagctaatgaatacaaggttgtgcaaattgta
gaaaattgtgagtattcagatgatgagcaaacatatcaacattgtattgcttatccatacacggctgaggtatacaccac
ggctgctaacttttggaaagagatcaagattgatatatcaagttcaacccatccctatcccttttctgtgtacttgaagg
gattttgttattggtttgcaacggatggcgaagaatgcatactttcatttgatttaggtgatgagatatttcatagaata
caattgccttctaagatagaatccagttttaacttttgtggtctttttctttataatgaatctatcacttcttattgttg
tcgttatgatccaagtgaggattctaaattattt
back to top
>KC701628.1-SFBB3.m1834
aaatgcatatgcaagtcttggtgcactctcatcaatagtccaagttttgtggccaaacacctcagcaattccttggacaa
caaactcttatcctccacttgtatccttctcaaccgttctcagtttcacattttcccggatcagagttggaaacgtgaag
ttttatggtccatgattaatctttccattgatagtgatgtgcacaaccttcattatgatgttaagcccttgaatataccg
tttcctagggatgaccataatcctatagagattcacggttattgcaatgggattgtatgtctaatagaaggggataatgt
tcttctgtgcaatccttcaacgagggaattcaggctacttcccaattcatgccttcttgtaccccatcccgagggaaaat
tcgaattggaaacgacctttcacggaatgggttttggctacgattgcaaagctaaagaatacaaggttgtgcaaattata
gaaaattgtgagtattcagatgatgagcaaacatatcaacatcgtattgcttatccttacacggctgaggtatacaccac
ggctgctaacttttggaaagagatcaagattaatatatcaagtacaatccatccctatcctttttctgtgtacttgaagg
gattttgttattggtttgcaacagatggcgaggaatgcatactttcatttgatttaggtgatgagatatttcatagaata
caattgccttctaagatagaatccggttttgagttttgtggtctttttctttataatgaatctatcacttcttattgttg
tcataacgatccaagtgaggattctaaattattt
back to top
>KC701625.1-SFBB3.m1834
aaatgcatacgcaagtcttggtgcactctgatcaatagtccaagttttgtggccaaacacctcagcaattccttggacaa
caaactctcatcctccacttgtatccttctcaaccgttctcagtttcacattttcccggatcagagttggaaacgtgaag
ttttatggtccatgattaatctttcgattgatagtgatgtgcacaaccttcattatgatgttaagcccttaaatataccg
ttttctagggatgaccataatcctgtacagattcacgggtattgcaatgggattgtatgtctaatagaaggggataatgt
tcttctatgcaatccttcaacgagggaattcaggctacttcccaattcatgccttcttgtaccccatcccgagggaaaat
tcgaattggaaacgacctttcacggaatgggttttggctatgattgcaaagctaatgaatacaaggttgtgcaaattgta
gaaaattgtgagtattcagatgatgagcaaacatatcaacattgtattgcttatccatacacggctgaggtatacaccac
ggctgctaacttttggaaagagatcaagattgatatatcaagttcaacccatccctatcccttttctgtgtacttgaagg
gattttgttattggtttgcaacggatggcgaagaatgcatactttcatttgatttaggtgatgagatatttcatagaata
caattgccttctaagatagaatccagttttaacttttgtggtctttttctttataatgaatctatcacttcttattgttg
tcgttatgatccaagtgaggattctaaattattt
back to top