SFBB4-U3, SFBB4-U3 (gene) Pyrus pyrifolia

Gene Overview
Name SFBB4-U3
Gene Symbol SFBB4-U3
Type gene
Organism Pyrus pyrifolia
Synonym hypothetical protein
PpSFBB4-u3
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB4-U3AB545981.1-SFBB4-U3Pyrus pyrifoliagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB4-U3AB545981.1-SFBB4-U3.m2Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB545981.1-SFBB4-U3 scaffold07498:2458..3631
AB545981.1
mRNA parsed from NCBI nr database AB545981.1-SFBB4-U3.m2 scaffold07498:2458..3631
AB545981.1

Sequence(s):
>AB545981.1-SFBB4-U31173
atgtcccaggtgtgtgaaagtgagactcctgaagataaagtggtcgaaatcttgtccaagttgccgcccaagtctctgat
gagattcaaatgcatacgcaagtcttggtgcactatcatctgtagtccaagttttgtggccaaacacctcagcaattcca
tggacaacaaactctcatccaccgcttgtatccttctctaccgttgtcaggttcatgttttcacgaacacgagttggaaa
caagacgttttctggtccatgattaatctttccattgatagtgataaccttcattatgatgttgagaacctaaatatacc
gtttccaatggaagatcaagacaacgtagagcttcacggttattgccatgggattgtctgtttaatagtagggaaaaatg
ttcttttatgcaatcctgcaacaggacaattcaggcaacttcccgattcatcccttcttctaccccttcccaagggaaga
ttcggattggaaacgatctttaagggaatgggatttggttatgattgcaaagctaaagaatacaaggttgtgcgaattat
agaaaattgtgattgtgagtattcggaagatggagaatcatactatgagcgtattcttcttcctcacacggctgaggtat
acaccacgactacgaactcttggaaagagatcaagattgatatatcaattgaaactcgttggtattgcattcccttttct
ggttcagtgtacttgaagggattttgttattggtttgcatacgataacggggagtacgtattttcatttgatttaggtga
tgagatatttcatagaatagaattgccttctaggagagaatccgatttcaagttttatggtatttttctgtataatgaat
ctgtcgcttcgtattgctatcgtcatgaagatgattgtgaattatttgaaatatgggtaatggacgactatgatggagtt
cagagttcatggacaaaattgctaaccgttggaccccttaaagacattgattatccattgacactttggaaatgtgacga
gattcttatgcttggctcatatggaaaagctgcctcatgtaattctattactggaaatctcaagtatcttcatattcctc
ctattatcaaatggatgatgaattatgtgaaaagtattgttccagtcaagtga
back to top
>AB545981.1-SFBB4-U3.m21173
atgtcccaggtgtgtgaaagtgagactcctgaagataaagtggtcgaaatcttgtccaagttgccgcccaagtctctgat
gagattcaaatgcatacgcaagtcttggtgcactatcatctgtagtccaagttttgtggccaaacacctcagcaattcca
tggacaacaaactctcatccaccgcttgtatccttctctaccgttgtcaggttcatgttttcacgaacacgagttggaaa
caagacgttttctggtccatgattaatctttccattgatagtgataaccttcattatgatgttgagaacctaaatatacc
gtttccaatggaagatcaagacaacgtagagcttcacggttattgccatgggattgtctgtttaatagtagggaaaaatg
ttcttttatgcaatcctgcaacaggacaattcaggcaacttcccgattcatcccttcttctaccccttcccaagggaaga
ttcggattggaaacgatctttaagggaatgggatttggttatgattgcaaagctaaagaatacaaggttgtgcgaattat
agaaaattgtgattgtgagtattcggaagatggagaatcatactatgagcgtattcttcttcctcacacggctgaggtat
acaccacgactacgaactcttggaaagagatcaagattgatatatcaattgaaactcgttggtattgcattcccttttct
ggttcagtgtacttgaagggattttgttattggtttgcatacgataacggggagtacgtattttcatttgatttaggtga
tgagatatttcatagaatagaattgccttctaggagagaatccgatttcaagttttatggtatttttctgtataatgaat
ctgtcgcttcgtattgctatcgtcatgaagatgattgtgaattatttgaaatatgggtaatggacgactatgatggagtt
cagagttcatggacaaaattgctaaccgttggaccccttaaagacattgattatccattgacactttggaaatgtgacga
gattcttatgcttggctcatatggaaaagctgcctcatgtaattctattactggaaatctcaagtatcttcatattcctc
ctattatcaaatggatgatgaattatgtgaaaagtattgttccagtcaagtga
back to top