SFBB4, SFBB4 (gene) Sorbus aucuparia

Gene Overview
Name SFBB4
Gene Symbol SFBB4
Type gene
Organism Sorbus aucuparia
Synonym SFBB5
SFBB4
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB4KC701652.1-SFBB4Sorbus aucupariagene
SFBB4KC701627.1-SFBB4Sorbus aucupariagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB4KC701652.1-SFBB4.m1Sorbus aucupariamRNA
SFBB4KC701627.1-SFBB4.m1Sorbus aucupariamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBSorbus aucupariagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KC701652.1-SFBB4 N/A KC701652.1
gene parsed from NCBI nr database KC701627.1-SFBB4 N/A KC701627.1
mRNA parsed from NCBI nr database KC701652.1-SFBB4.m1 N/A KC701652.1
mRNA parsed from NCBI nr database KC701627.1-SFBB4.m1 N/A KC701627.1

Sequence(s):
>KC701652.1-SFBB4837
aaatgcatacgcaaggcttggtgcactctcatcaatagtccaagttttgtggccaaacacctcagcaattctgtggacaa
caaattctcatcgtccacttgtatcctcctcaaccgttctcaggttcacgttttcccggacaagagttggaaacatgaag
ttttatggtccatgattaatctttttaatgatagagttgcacaaaccctttattatggtgttgaggacctaaatataccg
tttccaagggatgaccatcaacatgtactgattcatggttattgcaatggaattgtttgtgtaatatcagggaaaaatat
tcttttatgcaatccttcaacgagggaattcaggcaacttcctgattcattccttctcctaccttcccctctcggcggaa
aattcgaattggagaccgactttggaggattgggatttggctatgattgcagagctaaagattacaaggttgtgcgaatt
atagaaaattgtgagtattcagatgatgagcgaacatattatcatcgtattcctctgcctcacacggctgaggtatacac
catggctactaactcttggaaagagatcaagattgatatatcaagtaaaacttatccctgttcttgttcagtgtacttga
agggattttgttattggtttacaagggatggtgaagaattcatactttcatttgatttaagcgatgagagatttcataga
atacaattgccttctaggagagaatccggtttggagttttattatatttttctgtgtaatgaatccattgcttctttttg
ctctctttataatcgaagtgaagattctaaatcatgt
back to top
>KC701627.1-SFBB4837
aaatgcatacgcaagtcttggtgcactctcatcaatagtccaagttttgtggccaaacacctcagcaattctgtggacaa
caaattctcatcctccacttgtatcctcctcaaccgttctcaggttcacgttttcccggacaagagttggaaacatgaag
ttctatggtccatgattaatctttttaatgatagaattgcacacagcctttattatgatgttgaggacctaaatataccg
tttccaagggatgaccatcaacatgtactgattcatggttattgcaatggaattgtctgtgtaatatcaggggaaaatat
tcttttatgcaatcctgcaacgagggaattcaggcaacttcctgattcattccttctcctaccttcccctctcgacggaa
aattcgaattggagaccgattttggaggattgggatttggctatgattgcagagctaaagattacaaggttgtgcgaatt
atagaaaattgtgagtattcagattatgagcgaacatattatcatcgtattcctctgcctcacacggctgaggtatacac
catggctactaactcttggaaagagatcaagattgatatatcaagtaaaacttatccctgttcttgttcagtgtacttga
agggattttgttattggtttacaagggatggtgaggaattcatcctttcatttgatttaggcgatgagagatttcataga
atacaattgccttctaggagagaatccggttttgagttttattatatttttctgtgtaatgaatccattgcttctttttg
ctctctttatgatcgaagtgaagattctaaatcatgt
back to top
>KC701652.1-SFBB4.m1837
aaatgcatacgcaaggcttggtgcactctcatcaatagtccaagttttgtggccaaacacctcagcaattctgtggacaa
caaattctcatcgtccacttgtatcctcctcaaccgttctcaggttcacgttttcccggacaagagttggaaacatgaag
ttttatggtccatgattaatctttttaatgatagagttgcacaaaccctttattatggtgttgaggacctaaatataccg
tttccaagggatgaccatcaacatgtactgattcatggttattgcaatggaattgtttgtgtaatatcagggaaaaatat
tcttttatgcaatccttcaacgagggaattcaggcaacttcctgattcattccttctcctaccttcccctctcggcggaa
aattcgaattggagaccgactttggaggattgggatttggctatgattgcagagctaaagattacaaggttgtgcgaatt
atagaaaattgtgagtattcagatgatgagcgaacatattatcatcgtattcctctgcctcacacggctgaggtatacac
catggctactaactcttggaaagagatcaagattgatatatcaagtaaaacttatccctgttcttgttcagtgtacttga
agggattttgttattggtttacaagggatggtgaagaattcatactttcatttgatttaagcgatgagagatttcataga
atacaattgccttctaggagagaatccggtttggagttttattatatttttctgtgtaatgaatccattgcttctttttg
ctctctttataatcgaagtgaagattctaaatcatgt
back to top
>KC701627.1-SFBB4.m1837
aaatgcatacgcaagtcttggtgcactctcatcaatagtccaagttttgtggccaaacacctcagcaattctgtggacaa
caaattctcatcctccacttgtatcctcctcaaccgttctcaggttcacgttttcccggacaagagttggaaacatgaag
ttctatggtccatgattaatctttttaatgatagaattgcacacagcctttattatgatgttgaggacctaaatataccg
tttccaagggatgaccatcaacatgtactgattcatggttattgcaatggaattgtctgtgtaatatcaggggaaaatat
tcttttatgcaatcctgcaacgagggaattcaggcaacttcctgattcattccttctcctaccttcccctctcgacggaa
aattcgaattggagaccgattttggaggattgggatttggctatgattgcagagctaaagattacaaggttgtgcgaatt
atagaaaattgtgagtattcagattatgagcgaacatattatcatcgtattcctctgcctcacacggctgaggtatacac
catggctactaactcttggaaagagatcaagattgatatatcaagtaaaacttatccctgttcttgttcagtgtacttga
agggattttgttattggtttacaagggatggtgaggaattcatcctttcatttgatttaggcgatgagagatttcataga
atacaattgccttctaggagagaatccggttttgagttttattatatttttctgtgtaatgaatccattgcttctttttg
ctctctttatgatcgaagtgaagattctaaatcatgt
back to top