SFBB5-S6, SFBB5-S6 (gene) Pyrus pyrifolia

Gene Overview
Name SFBB5-S6
Gene Symbol SFBB5-S6
Type gene
Organism Pyrus pyrifolia
Synonym S-locus F-box brothers5-S6
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB5-S6AB621614.1-SFBB5-S6.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB621614.1-SFBB5-S6.m1 scaffold02213:14881..15670
AB621614.1

Sequence(s):
>AB621614.1-SFBB5-S6.m1789
aaccttcattacgatgttgaggacctaaatataccatttccaatggaagatcaagacaatgtagagcttcacggttattg
caatgggattgtccgtgtaatagtaggggaaaatgttcttttatgcaatcctgcaacggaagaattcaggcaacttcccg
attcatcccttcttctaccccttcccaagggaagattcggattggaaacggtctttaagggattgggatttggctatgat
tgcaaagctaaagaatacaaggtcgtgcgaattatagaaaattgtgattgtgagtattcagaaggtgaagaatcatatta
tgagcgtattcttcttcctcacacggctgaggtatacaccatgactactaactcttggaaagagatcaagattgatgtaa
caagtgatactgatccgtattgcattccttattcttgttcagtgtatttgaagggattttgttattggtttgcaatggat
aacggggaatacatattttcatttgatttaggtgatgagatatttcatataatagaattgccttctaggagagaatttga
ttttaagttttatggcatatttttgtataatgaatccatcacttcttattgctctcgttacgaagaggattgtaaattat
ttgaaatatgggtaatggacgactatgatggagttaagagttcatggacaaaattgctaactgttggaccctttaaagac
attgattatccattgacacttgggaaatgtgacgaggttcttatgcttggctcgtatggaagagcggcc
back to top