SFBB6-gamma, SFBB6-gamma (gene) Pyrus pyrifolia

Gene Overview
Name SFBB6-gamma
Gene Symbol SFBB6-gamma
Type gene
Organism Pyrus pyrifolia
Synonym PpSFBB6-gamma
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB6-gammaAB297936.1-SFBB6-gammaPyrus pyrifoliagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB6-gammaAB297936.1-SFBB6-gamma.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB297936.1-SFBB6-gamma scaffold01086:55112..56303
AB297936.1
mRNA parsed from NCBI nr database AB297936.1-SFBB6-gamma.m1 scaffold01086:55112..56303
AB297936.1

Sequence(s):
>AB297936.1-SFBB6-gamma1191
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
cggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatactgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaccagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtggaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaaacgtgacggtatttttc
tgtacaatgaatccctcacttattattgcagtagttatgaagagccttccacattatttgagatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttgttattaatcagaataggattgtagattacgtgaaaagtattattctagtcaattga
back to top
>AB297936.1-SFBB6-gamma.m11191
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
cggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatactgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaccagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgattgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtggaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaaacgtgacggtatttttc
tgtacaatgaatccctcacttattattgcagtagttatgaagagccttccacattatttgagatatgggtaatggactac
gatgacggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttgttattaatcagaataggattgtagattacgtgaaaagtattattctagtcaattga
back to top