SFBB7, SFBB7 (gene) Sorbus aucuparia

Gene Overview
Name SFBB7
Gene Symbol SFBB7
Type gene
Organism Sorbus aucuparia
Synonym SFBB7
Description NA
Comment allele linked with S22-RNase
allele linked with Sc-RNase
allele linked with Sa-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB7KC701694.1-SFBB7Sorbus aucupariagene
SFBB7KC701693.1-SFBB7Sorbus aucupariagene
SFBB7KC701692.1-SFBB7Sorbus aucupariagene
SFBB7KC701691.1-SFBB7Sorbus aucupariagene
SFBB7KC701663.1-SFBB7Sorbus aucupariagene
SFBB7KC701662.1-SFBB7Sorbus aucupariagene
SFBB7KC701640.1-SFBB7Sorbus aucupariagene
SFBB7KC701626.1-SFBB7Sorbus aucupariagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB7KC701694.1-SFBB7.m1Sorbus aucupariamRNA
SFBB7KC701693.1-SFBB7.m1Sorbus aucupariamRNA
SFBB7KC701692.1-SFBB7.m1Sorbus aucupariamRNA
SFBB7KC701691.1-SFBB7.m1Sorbus aucupariamRNA
SFBB7KC701663.1-SFBB7.m1Sorbus aucupariamRNA
SFBB7KC701662.1-SFBB7.m1Sorbus aucupariamRNA
SFBB7KC701640.1-SFBB7.m1Sorbus aucupariamRNA
SFBB7KC701626.1-SFBB7.m1Sorbus aucupariamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBSorbus aucupariagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KC701694.1-SFBB7 N/A KC701694.1
gene parsed from NCBI nr database KC701693.1-SFBB7 N/A KC701693.1
gene parsed from NCBI nr database KC701692.1-SFBB7 N/A KC701692.1
gene parsed from NCBI nr database KC701691.1-SFBB7 N/A KC701691.1
gene parsed from NCBI nr database KC701663.1-SFBB7 N/A KC701663.1
gene parsed from NCBI nr database KC701662.1-SFBB7 N/A KC701662.1
gene parsed from NCBI nr database KC701640.1-SFBB7 N/A KC701640.1
gene parsed from NCBI nr database KC701626.1-SFBB7 N/A KC701626.1
mRNA parsed from NCBI nr database KC701694.1-SFBB7.m1 N/A KC701694.1
mRNA parsed from NCBI nr database KC701693.1-SFBB7.m1 N/A KC701693.1
mRNA parsed from NCBI nr database KC701692.1-SFBB7.m1 N/A KC701692.1
mRNA parsed from NCBI nr database KC701691.1-SFBB7.m1 N/A KC701691.1
mRNA parsed from NCBI nr database KC701663.1-SFBB7.m1 N/A KC701663.1
mRNA parsed from NCBI nr database KC701662.1-SFBB7.m1 N/A KC701662.1
mRNA parsed from NCBI nr database KC701640.1-SFBB7.m1 N/A KC701640.1
mRNA parsed from NCBI nr database KC701626.1-SFBB7.m1 N/A KC701626.1

Sequence(s):
>KC701694.1-SFBB7578
tgtggccaaacacctcagcaattccatggacaacaaactctcatccaccgcttgtatccttctcaaccgttgtcaggttc
atgttttcccggacaggagttggaagcaagacgttttctggtccatgattaatctttccattgatagtgatgagaataac
tttcattatgatgttgaggacctaaatataccgtttccaagggaagatcaagacaatgtagagcttcacggttattgcaa
tgggattgcctgtgtaatagtagggaaaaatgttcttttatgcaatcctgcaacgggagaattcaggcaacttcccgatt
catcacttcttataccccttcccaagggaagattcggattggaaacgacctttaaaggaatgggatttggctatgattgc
aaaactaaagaatacaaggttgtgcgaattatagaaaattgtgattgtgagtattcagaagatggagaatcatactatga
gcgtattcttcttcctcacacggctgaggtatacaccacgactgctaactcttggaaagagatcaagattgatatatcaa
ttgaaactcgttggtatt
back to top
>KC701693.1-SFBB7578
tgtggccaaacacctcaacaattccatggacaacaaactctcatccaccacttgtatccttctcaaccgttgtcaggttc
acgttttcccggacaggagttggaaacaagacgttttctggtccatgattaatctttccattgatagtgatgagcacaac
cttcattatgatgttgaggacctaaatataccgtttccaatagaagatcaagacaatgtagagcttcatggttattgcaa
tgggattgtctgtgtaatagcaggggaaaatgttcttttatgcaatcctgcaacgagagaattcaggcaacttccgaatt
catctcttcttctaccccttcccaagggaagatttggattggaaacgacatttaaaggaatgggatttggctatgattgc
aaaactaaagaatacaaggttgtgcgaattatagaaaattgtgattgtgagtattcagatgatggagaatcatactatga
gcgtattcttcttcctcacacggctgaggtatacaccacggctgctaactcttggaaagagatcaagattgatatatcaa
ttgaaactggttggtatt
back to top
>KC701692.1-SFBB7578
tgtggccaaacacctcagcaattccatggacaacaaactctcatccaccgcttgtatccttttcaaccgttgtcaggttc
atgttttcacgaacacgagttggaaacaagacattttctggtccatgattaatctttccattgatagtgatgagcacaac
cttcattatgatgttgaggacctaaatataccgtttccaatggaagatcaagacaatgtagagcttcacggttattgcaa
tgggattgtctgtgtaatagtagggaaaaatgttcttttatgcaatcctgcaacgggagaattcaggcaacttcccgatt
catcccttcttctaccccttcccaagggaagattcggattggaaacgatctttaagggaatgggatttggctatgattgc
aaagctaaagaatacaaggttgtgcgaattatagaaaattgtgattgtgagtattcggaagatggagaatcatactatga
gcgtattcttcttcctcacaaagctgaggtatacaccacgactactaactcttggaaagagatcaagattgatatatcaa
ttgaaactcgttggtatt
back to top
>KC701691.1-SFBB7578
tgtggccaaacacctcagcaattccatggacaacaaattctcatccaccacttgtatccttctcaaccgttgtcaggttc
acgttttctcggacaggagttggaaacaagacgttttctggtccatgattaatctttccattgatagtgatgagcacaac
cttcattatgatgttgagaacctaaatatacggtttccaatggaagatcaagacaatgtagagcttcacggttattgcaa
tgggattgtctgtgtaatagcaggaaaaaatgttcttttatgcaatcctgcaacgggagaattcaggcagcttcccaatt
catctcttcttctaccccttcccaagggaagattcggattggaaacgacctttaaaggaatgggatttggctatgattgc
aaagctaaagaatacaaggttgtgcgaattatagaaaattgtgattgtgagtattcagatgatggagaatcatactatga
gcgtattcttcttcctcacacggctgaggtatacaccacgactgctaactcttggaaagagatcaagattgatatatcaa
ttgaaactcgttggtatt
back to top
>KC701663.1-SFBB7846
aaatgcatacgcaagtcttggtgcactatcatcaatagtccaagttttgtggccaaacacctcagcaattccatggacaa
caaactctcatccaccacttgtatccttcttaaccgttgtcaggttcacgttttcccggacaggagttggaaacaagacg
ttttatggtccatgattaatctttccattgatagtgatgagcacaaccttcattatgatgttgagtccgtaaatataccg
tttccaatggaagatcaagacaatgtagagcttcacggttactgcaatgggattgtctgtgtgatagtacggaaaaatgt
tcttttatgcaatcctgcaacgggagaattcaggcaccttcccaattcatctcttcttctaccccttcccaagggaagat
tcggattggaaacgacttttaaaggaatgggatttggctatgattgcaaaagtaaagaatacaaggttgtgcgaataata
gaaaattgtgattgtgagtattcagaggatagagaatcatactatgagcgtattcttcttcctcacacggctgaggtata
caccccgactgctaactcttggaaagagatcaagattgatatatcaattgaaactcgttggtattgcattccctattctg
gttcagtgtacttgaagggattttgttattggtttgcatacgataatggggagtacgtattctcatttgatttaggtgat
gagatatttcatagaatagaattgccttctaggagagaatccgattttgagtttcgtggtatttttctgtataatgaatc
tgtcacttcgtattgctttcgtcacgaagaggattgtgaattattt
back to top
>KC701662.1-SFBB7846
aaatgcatacgcaagtcttggtgcactatcatcaatagtccaagttttgtggccaaacacctcagcaattccatggacaa
caaactctcatccaccacttgtatccttcttaaccgttgtcaggttcacgttttcccggacaggagttggaaacaagacg
ttttatggtccatgattaatctttccattgatagtgatgagcacaaccttcattatgatgttgagtccgtaaatataccg
tttccaatggaagatcaagacaatgtagagcttcacggttactgcaatgggattgtctgtgtgatagtacggaaaaatgt
tcttttatgcaatcctgcaacgggagaattcaggcaccttcccaattcatctcttcttctaccccttcccaagggaagat
tcggattggaaacgacttttaaaggaatgggatttggctatgattgcaaaagtaaagaatacaaggttgtgcgaataata
gaaaattgtgattgtgagtattcagaggatagagaatcatactatgagcgtattcttcttcctcacacggctgaggtata
caccccgactgctaactcttggaaagagataaagattgatgtaacaagtgatactgatccgtattgcattccttattctt
gttcggtgtacttgaagggattttgttattggtttgcaatggataacggggaatacatattttcatttgatttaggtgaa
gagatatttcatataatagaattgccttctaggagagaatttgattttaagttttatggtatctttttatataatgaatc
catcacttcttattgctctcgttacgaagaggattgtaaattattt
back to top
>KC701640.1-SFBB7798
caatgcatacgcaagtcttggtgctctatcatcaatagtccaagttttgtggccaaacatctcagcaattccatggacaa
caaactctcatccaccacttgtgtccttctcaaccgttgtcaggttcacgttttcccggacaagagttggaaacaagacg
ttttctggtccatgattaatctttccattgatagtgatgagcacaaccttcattatgatgttgaggacctaaatataccg
tttctaatggaagatcaagacaatgtagatcttcacggttattgcaatgggattgtctgtgtaatagcagggaaaaatgt
tcttttatgcaatcctgcaactggagaattcaggcaacttcccaattcatctcttcttctaccccttcccaagggaagat
tcggattggaaacgacctttaaaggaatgggatttggctatgattgcaaaactgaagagtacaaggttgtgcgaattata
gaaaattgtgattgtgagtattcagatgatggagaatcatactatgagcgtattcttcttcctcacaaggctgaggtata
caccacgactgctaactcttggaaagagatcaagattgatatatcaattgaaactcgttggtactgcattccctattctg
gttcagtgtacttgaagggattttgttattggtttgcatacgataacggggagtacgtattttcatttgatttaggtgat
gagatatttcatagaatagaattgccttctaggagagaatcgaatttcaagttttatggtatttttctgtataatgaa
back to top
>KC701626.1-SFBB7846
aaatgcatacgcaagtcttggtgcactatcatcaatagtccaagttttgtggccaaacacctcagcaattccatggacaa
caaactctcatccaccacttgtatccttcttaaccgttgtcaggttcacgttttcccggacaggagttggaaacaagacg
ttttatggtccatgattaatctttccattgatagtgatgagcacaaccttcattatgatgttgagtccgtaaatataccg
tttccaatggaagatcaagacaatgtagagcttcacggttactgcaatgggattgtctgtgtgatagtacggaaaaatgt
tcttttatgcaatcctgcaacgggagaattcaggcaccttcccaattcatctcttcttctaccccttcccaagggaagat
tcggattggaaacgacttttaaaggaatgggatttggctatgattgcaaaagtaaagaatacaaggttgtgcgaataata
gaaaattgtgattgtgagtattcagaggatagagaatcatactatgagcgtattcttcttcctcacacggctgaggtata
caccccgactgctaactcttggaaagagatcaagattgatatatcaattgaaactcgttggtattgcattccctattctg
gttcagtgtacttgaagggattttgttattggtttgcatacgataatggggagtacgtattctcatttgatttaggtgat
gagatatttcatagaatagaattgccttctaggagagaatccgattttgagtttcgtggtatttttctgtataatgaatc
tgtcacttcgtattgctttcgtcacgaagaggattgtgaattattt
back to top
>KC701694.1-SFBB7.m1578
tgtggccaaacacctcagcaattccatggacaacaaactctcatccaccgcttgtatccttctcaaccgttgtcaggttc
atgttttcccggacaggagttggaagcaagacgttttctggtccatgattaatctttccattgatagtgatgagaataac
tttcattatgatgttgaggacctaaatataccgtttccaagggaagatcaagacaatgtagagcttcacggttattgcaa
tgggattgcctgtgtaatagtagggaaaaatgttcttttatgcaatcctgcaacgggagaattcaggcaacttcccgatt
catcacttcttataccccttcccaagggaagattcggattggaaacgacctttaaaggaatgggatttggctatgattgc
aaaactaaagaatacaaggttgtgcgaattatagaaaattgtgattgtgagtattcagaagatggagaatcatactatga
gcgtattcttcttcctcacacggctgaggtatacaccacgactgctaactcttggaaagagatcaagattgatatatcaa
ttgaaactcgttggtatt
back to top
>KC701693.1-SFBB7.m1578
tgtggccaaacacctcaacaattccatggacaacaaactctcatccaccacttgtatccttctcaaccgttgtcaggttc
acgttttcccggacaggagttggaaacaagacgttttctggtccatgattaatctttccattgatagtgatgagcacaac
cttcattatgatgttgaggacctaaatataccgtttccaatagaagatcaagacaatgtagagcttcatggttattgcaa
tgggattgtctgtgtaatagcaggggaaaatgttcttttatgcaatcctgcaacgagagaattcaggcaacttccgaatt
catctcttcttctaccccttcccaagggaagatttggattggaaacgacatttaaaggaatgggatttggctatgattgc
aaaactaaagaatacaaggttgtgcgaattatagaaaattgtgattgtgagtattcagatgatggagaatcatactatga
gcgtattcttcttcctcacacggctgaggtatacaccacggctgctaactcttggaaagagatcaagattgatatatcaa
ttgaaactggttggtatt
back to top
>KC701692.1-SFBB7.m1578
tgtggccaaacacctcagcaattccatggacaacaaactctcatccaccgcttgtatccttttcaaccgttgtcaggttc
atgttttcacgaacacgagttggaaacaagacattttctggtccatgattaatctttccattgatagtgatgagcacaac
cttcattatgatgttgaggacctaaatataccgtttccaatggaagatcaagacaatgtagagcttcacggttattgcaa
tgggattgtctgtgtaatagtagggaaaaatgttcttttatgcaatcctgcaacgggagaattcaggcaacttcccgatt
catcccttcttctaccccttcccaagggaagattcggattggaaacgatctttaagggaatgggatttggctatgattgc
aaagctaaagaatacaaggttgtgcgaattatagaaaattgtgattgtgagtattcggaagatggagaatcatactatga
gcgtattcttcttcctcacaaagctgaggtatacaccacgactactaactcttggaaagagatcaagattgatatatcaa
ttgaaactcgttggtatt
back to top
>KC701691.1-SFBB7.m1578
tgtggccaaacacctcagcaattccatggacaacaaattctcatccaccacttgtatccttctcaaccgttgtcaggttc
acgttttctcggacaggagttggaaacaagacgttttctggtccatgattaatctttccattgatagtgatgagcacaac
cttcattatgatgttgagaacctaaatatacggtttccaatggaagatcaagacaatgtagagcttcacggttattgcaa
tgggattgtctgtgtaatagcaggaaaaaatgttcttttatgcaatcctgcaacgggagaattcaggcagcttcccaatt
catctcttcttctaccccttcccaagggaagattcggattggaaacgacctttaaaggaatgggatttggctatgattgc
aaagctaaagaatacaaggttgtgcgaattatagaaaattgtgattgtgagtattcagatgatggagaatcatactatga
gcgtattcttcttcctcacacggctgaggtatacaccacgactgctaactcttggaaagagatcaagattgatatatcaa
ttgaaactcgttggtatt
back to top
>KC701663.1-SFBB7.m1846
aaatgcatacgcaagtcttggtgcactatcatcaatagtccaagttttgtggccaaacacctcagcaattccatggacaa
caaactctcatccaccacttgtatccttcttaaccgttgtcaggttcacgttttcccggacaggagttggaaacaagacg
ttttatggtccatgattaatctttccattgatagtgatgagcacaaccttcattatgatgttgagtccgtaaatataccg
tttccaatggaagatcaagacaatgtagagcttcacggttactgcaatgggattgtctgtgtgatagtacggaaaaatgt
tcttttatgcaatcctgcaacgggagaattcaggcaccttcccaattcatctcttcttctaccccttcccaagggaagat
tcggattggaaacgacttttaaaggaatgggatttggctatgattgcaaaagtaaagaatacaaggttgtgcgaataata
gaaaattgtgattgtgagtattcagaggatagagaatcatactatgagcgtattcttcttcctcacacggctgaggtata
caccccgactgctaactcttggaaagagatcaagattgatatatcaattgaaactcgttggtattgcattccctattctg
gttcagtgtacttgaagggattttgttattggtttgcatacgataatggggagtacgtattctcatttgatttaggtgat
gagatatttcatagaatagaattgccttctaggagagaatccgattttgagtttcgtggtatttttctgtataatgaatc
tgtcacttcgtattgctttcgtcacgaagaggattgtgaattattt
back to top
>KC701662.1-SFBB7.m1846
aaatgcatacgcaagtcttggtgcactatcatcaatagtccaagttttgtggccaaacacctcagcaattccatggacaa
caaactctcatccaccacttgtatccttcttaaccgttgtcaggttcacgttttcccggacaggagttggaaacaagacg
ttttatggtccatgattaatctttccattgatagtgatgagcacaaccttcattatgatgttgagtccgtaaatataccg
tttccaatggaagatcaagacaatgtagagcttcacggttactgcaatgggattgtctgtgtgatagtacggaaaaatgt
tcttttatgcaatcctgcaacgggagaattcaggcaccttcccaattcatctcttcttctaccccttcccaagggaagat
tcggattggaaacgacttttaaaggaatgggatttggctatgattgcaaaagtaaagaatacaaggttgtgcgaataata
gaaaattgtgattgtgagtattcagaggatagagaatcatactatgagcgtattcttcttcctcacacggctgaggtata
caccccgactgctaactcttggaaagagataaagattgatgtaacaagtgatactgatccgtattgcattccttattctt
gttcggtgtacttgaagggattttgttattggtttgcaatggataacggggaatacatattttcatttgatttaggtgaa
gagatatttcatataatagaattgccttctaggagagaatttgattttaagttttatggtatctttttatataatgaatc
catcacttcttattgctctcgttacgaagaggattgtaaattattt
back to top
>KC701640.1-SFBB7.m1798
caatgcatacgcaagtcttggtgctctatcatcaatagtccaagttttgtggccaaacatctcagcaattccatggacaa
caaactctcatccaccacttgtgtccttctcaaccgttgtcaggttcacgttttcccggacaagagttggaaacaagacg
ttttctggtccatgattaatctttccattgatagtgatgagcacaaccttcattatgatgttgaggacctaaatataccg
tttctaatggaagatcaagacaatgtagatcttcacggttattgcaatgggattgtctgtgtaatagcagggaaaaatgt
tcttttatgcaatcctgcaactggagaattcaggcaacttcccaattcatctcttcttctaccccttcccaagggaagat
tcggattggaaacgacctttaaaggaatgggatttggctatgattgcaaaactgaagagtacaaggttgtgcgaattata
gaaaattgtgattgtgagtattcagatgatggagaatcatactatgagcgtattcttcttcctcacaaggctgaggtata
caccacgactgctaactcttggaaagagatcaagattgatatatcaattgaaactcgttggtactgcattccctattctg
gttcagtgtacttgaagggattttgttattggtttgcatacgataacggggagtacgtattttcatttgatttaggtgat
gagatatttcatagaatagaattgccttctaggagagaatcgaatttcaagttttatggtatttttctgtataatgaa
back to top
>KC701626.1-SFBB7.m1846
aaatgcatacgcaagtcttggtgcactatcatcaatagtccaagttttgtggccaaacacctcagcaattccatggacaa
caaactctcatccaccacttgtatccttcttaaccgttgtcaggttcacgttttcccggacaggagttggaaacaagacg
ttttatggtccatgattaatctttccattgatagtgatgagcacaaccttcattatgatgttgagtccgtaaatataccg
tttccaatggaagatcaagacaatgtagagcttcacggttactgcaatgggattgtctgtgtgatagtacggaaaaatgt
tcttttatgcaatcctgcaacgggagaattcaggcaccttcccaattcatctcttcttctaccccttcccaagggaagat
tcggattggaaacgacttttaaaggaatgggatttggctatgattgcaaaagtaaagaatacaaggttgtgcgaataata
gaaaattgtgattgtgagtattcagaggatagagaatcatactatgagcgtattcttcttcctcacacggctgaggtata
caccccgactgctaactcttggaaagagatcaagattgatatatcaattgaaactcgttggtattgcattccctattctg
gttcagtgtacttgaagggattttgttattggtttgcatacgataatggggagtacgtattctcatttgatttaggtgat
gagatatttcatagaatagaattgccttctaggagagaatccgattttgagtttcgtggtatttttctgtataatgaatc
tgtcacttcgtattgctttcgtcacgaagaggattgtgaattattt
back to top