SFBB8, SFBB8 (gene) Sorbus aucuparia

Gene Overview
Name SFBB8
Gene Symbol SFBB8
Type gene
Organism Sorbus aucuparia
Synonym SFBB8
Description NA
Comment allele linked with Sc-RNase
allele linked with S22-RNase
allele linked with Sa-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB8KC701698.1-SFBB8Sorbus aucupariagene
SFBB8KC701697.1-SFBB8Sorbus aucupariagene
SFBB8KC701696.1-SFBB8Sorbus aucupariagene
SFBB8KC701695.1-SFBB8Sorbus aucupariagene
SFBB8KC701658.1-SFBB8Sorbus aucupariagene
SFBB8KC701657.1-SFBB8Sorbus aucupariagene
SFBB8KC701615.1-SFBB8Sorbus aucupariagene
SFBB8KC701614.1-SFBB8Sorbus aucupariagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB8KC701698.1-SFBB8.m1Sorbus aucupariamRNA
SFBB8KC701697.1-SFBB8.m1Sorbus aucupariamRNA
SFBB8KC701696.1-SFBB8.m1Sorbus aucupariamRNA
SFBB8KC701695.1-SFBB8.m1Sorbus aucupariamRNA
SFBB8KC701658.1-SFBB8.m1Sorbus aucupariamRNA
SFBB8KC701657.1-SFBB8.m1Sorbus aucupariamRNA
SFBB8KC701615.1-SFBB8.m1Sorbus aucupariamRNA
SFBB8KC701614.1-SFBB8.m1Sorbus aucupariamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBSorbus aucupariagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KC701698.1-SFBB8 N/A KC701698.1
gene parsed from NCBI nr database KC701697.1-SFBB8 N/A KC701697.1
gene parsed from NCBI nr database KC701696.1-SFBB8 N/A KC701696.1
gene parsed from NCBI nr database KC701695.1-SFBB8 N/A KC701695.1
gene parsed from NCBI nr database KC701658.1-SFBB8 N/A KC701658.1
gene parsed from NCBI nr database KC701657.1-SFBB8 N/A KC701657.1
gene parsed from NCBI nr database KC701615.1-SFBB8 N/A KC701615.1
gene parsed from NCBI nr database KC701614.1-SFBB8 N/A KC701614.1
mRNA parsed from NCBI nr database KC701698.1-SFBB8.m1 N/A KC701698.1
mRNA parsed from NCBI nr database KC701697.1-SFBB8.m1 N/A KC701697.1
mRNA parsed from NCBI nr database KC701696.1-SFBB8.m1 N/A KC701696.1
mRNA parsed from NCBI nr database KC701695.1-SFBB8.m1 N/A KC701695.1
mRNA parsed from NCBI nr database KC701658.1-SFBB8.m1 N/A KC701658.1
mRNA parsed from NCBI nr database KC701657.1-SFBB8.m1 N/A KC701657.1
mRNA parsed from NCBI nr database KC701615.1-SFBB8.m1 N/A KC701615.1
mRNA parsed from NCBI nr database KC701614.1-SFBB8.m1 N/A KC701614.1

Sequence(s):
>KC701698.1-SFBB8861
gttttgtggccaaacacctcagcgattctgtggacaacaaactctcatcctccacttgtatccttctcaactgttctcag
gctcacgtttgctcggaagagagttggaaacaagaagttttatggtccgtgattaatctttccattgatggtgatgagct
tcattatgatattgaggacctaactaatgtaccgtttctaaaggatgaccatcatgaagtagagattcacggttattgcg
atgggattgtttgtgtaacagtacacgaaaatttctttttgtgcaatcctgcaacgagggaattcaggcaacttcctgat
tcataccttcttctaccccttcccggggtaaaagaaaaattcggattggaaacgacacttaaaggactgggatttggtta
tgattgcaaagccaaagaatacaaggttgtgcgaattatagataattatgattgtgagtattcagatgatggagaaacat
atatcgagcatattgctcttccttacactgctgaagtatacaccatggctgctaactcttggaaagagatcacgattgat
atattaagtaaaatattatcatcatttagcgaaccatattcttattcagtgtatttgaaagggttttgttattggttgtc
atgcgatgtagaggaatacatattttcatttgatttagctaatgaaatatctgatatgatagaattgccttataggggag
aattcggttttaagcgtgatggtatttttctgtataatgaatccctcacttattattgcactagttacgaagagccttcc
acattatttgaaatatgggtaatggactacgatgaaggatttaagagtttatggacaaaac
back to top
>KC701697.1-SFBB8861
gttttgtggccaaacacctcagcgattctgtggacaacaaactctcatcctccacttgtatccttctcaactgctctcag
gctcacgtttgctcggaagagagttggaaacaagaagttttatggtccgtgattaatctttccattgatggtgatgagct
tcattatgatattgaggacctagctaatgtaccgtttctaaaggatgaccatcatgaagtagagattcacggttattgcg
atgggattgtttgtgtaacagtaaaggaaaatttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgat
tcatgccttcttctaccccttcccggggtaaaagaaaaattcggattggaaacgacacttaaaggactgggatttggtta
tgattgcaaagctaaagaatacaaggttgtgcgaattatagataattatgattgtgagtattcagatgatggagaaacat
atatcgagcatattgctcttccttacactgctgaagtatacaccatggctgctaactcttggaaagagatcacgattgat
atattaagtaaaatattatcatcatatagcgaaccatattcttgttcagtgtatttgaaagggttttgttattggttgtc
atgcgatcaagaggaatacatattttcatttgatttagctaatgaaatatctgatatgatagaattgccttttaggggag
aattcggttttaagcgtgatggtatttttctgtataatgaatccctcacttattattgcactagttacgaagagccttcc
acattatttgaaatatgggtaatggactatgatgacggatttaagagttcatggacaaaac
back to top
>KC701696.1-SFBB8861
gttttgtggccaaacacctcagcgattctgtggacaacaaactctcatcctccacttgtatccttctcaactgttctcag
gctcacgtttgctcggaagagagttggaaacaagaagttttatggtccgtgattaatctttccattgatggtgatgagct
tcattatgatattgaggacctaactaatgtaccgtttctaaaggatgaccatcatgaagtagagattcacggttattgcg
atgggattgtttgtgtaacagtaaaggaaaatttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgat
tcatgccttcttctaccccttcccggggtaaaagaaaaattcggattggaaacgacacttaaaggactgggatttggtta
tgattgcaaagctaaagaatacaaggttgtgcgaattatagataattatgattgtgagtattcagatgatggagaaacat
atatcgagcatattgctcttccttacactgctgaagtatacaccatggctgctaactcttggaaagagatcacgattgat
atattaagtaaaatattatcatcatatagcgaaccatattcttattcagtgtatttgaaagggttttgttattggttgtc
atgcgatgtagaggaatacatattttcatttgatttagctaatgaaatatctgatatgatagaattgccttataggggag
aattcggttttaagcgtgatggtatttttctgtataatgaatccctcacttattattgcactagttacgaagagccttcc
acattatttgaaatatgggtaatggactacgatgacggatttaaaagtgcatggacaaaac
back to top
>KC701695.1-SFBB8861
gttttgtggccaaacacctcagcgattctgtggacaacaaactctcatcctccacttgtatccttctcaactgttctcag
gctcacgttggttcggaagagagttggaaacaagaagttttatggtccgtgattaatctttccattgatggtgatgagct
tcattatgatattgaggacctaactaatgtaccgtttctaaaggatgaccatcatgaagtagagattcacggttattgcg
atgggattgtctgtgtaacagtagaggaaaatttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgac
tcatgccttcttctaccccttcccggggtaaaagaaaaattcggattggaaacgacacttaaaggactgggatttggtta
tgattgcaaagctaaagaatacaaggttgtgcgaattatagataattatgattgtgagtattcagatgatggagaaacat
atatcgagcatattgctcttcctcacactgctgaagtatacaccatggctgctaactcttggaaagagatcacgattgat
atattaagtaaaatattatcatcatatagcgaaccatattcttgttcagtgtatttgaaagggttttgttattggttgtc
atgcgatcaagaggaatacatattttcatttgatttagctaatgaaatatctgatatgatagaattgccttttaggggag
aattcggttttaagcgtgatggtatttttctgtataatgaatccctcacttattattgcactagttacgatgagccttcc
acattatttgaaatatgggtaatggactacgatgacggatttaagagttcatggacaaaac
back to top
>KC701658.1-SFBB8852
aaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctgtggacaa
cagactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaagagagttggaaacaagaag
ttttatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatgtaccgttt
ctaaaggatgatcatcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaaatttctt
tttgtgcaatcctgcaacgagagaattcaggcaacttcctgactcatgccttcttctaccccttcccggggtaaaagaaa
aattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagccaaagaatacaaggttgtgcgaatt
atagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttccttacactgctgaagt
atacaccatggctgctaactcttggaaagagatcacgattgatatattaagtaaaatattatcatcatatagtgaaccat
attcttattcagtgtatttgaaagggttttgttattggttgtcatgcgatgtagaggaatacatattttcatttgattta
actaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttctgcataa
tgaatccctcacttattattgcactagttacgaagagccttccacattattt
back to top
>KC701657.1-SFBB8852
aaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctgtggacaa
cagactctcatcctccacttgtatccttcttaactgttctcaggctcacgtttgctcggaagagagttggaaacaagaag
ttttatggtctgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatgtaccgttt
ctaaaggacgaccatcatgaattagagattcacggttattgcgatgggattgtttgtgtaacagtaaacgaaaatttctt
tttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggtaaaagaaa
aattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgtgcgaatt
atagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttcctcacactgctgaagt
atacaccatggctactaactcttggaaagagatcacgattggtatattaagtaaaatattatcatcatatagcgaaccat
attcttgttcagtgtatttgaaagggttttgttattggttgtcatgcgatgaagaggaatacatattttcatttgattta
gctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttctgtataa
tgaatccctcacttattattgcactagttacgaagagccttccacattattt
back to top
>KC701615.1-SFBB8852
aaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctgtggacaa
cagactctcatcctccacttgtatccttcttaactgttctcaggctcacgtttgctcggaagagagttggaaacaagaag
ttttatggtctgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatgtaccgttt
ctaaaggacgaccatcatgaattagagattcacggttattgcgatgggattgtttgtgtaacagtaaacgaaaatttctt
tttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggtaaaagaaa
aattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgtgcgaatt
atagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttcctcacactgctgaagt
atacaccatggctactaactcttggaaagagatcacgattggtatattaagtaaaatattatcatcatatagcgaaccat
attcttgttcagtgtatttgaaagggttttgttattggttgtcatgcgatgaagaggaatacatattttcatttgattta
gctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttctgtataa
tgaatccctcacttattattgcactagttacgaagagccttccacattattt
back to top
>KC701614.1-SFBB8852
aaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctgtggacaa
caaactctcatcctccacttgtatccttctcaactgctctcaggctcacgtttgctcggaagagagttggaaacaagaag
ttttatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatataccgttt
ctaaaggatgatcatcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtaaaggaaaatttctt
tttgtgcaatcctgcaacgggggaattcagacaacttcctgattcatgccttcttctaccccttcccggggtaaaagaaa
aattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgtgcgaatt
atagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttccttacactgctgaagt
atacaccatggctgctaactcttggaaagagatcacgattgatatattaagtaaaatattatcatcatatagcgaaccat
attcttattcagtgtatttgaaagggttttgttattggttgtcatgcgatgtagaggaatacatattttcatttgattta
gctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttctgtataa
tgaatccctcacttattattgcactagttacgaagagccttccacattattt
back to top
>KC701698.1-SFBB8.m1861
gttttgtggccaaacacctcagcgattctgtggacaacaaactctcatcctccacttgtatccttctcaactgttctcag
gctcacgtttgctcggaagagagttggaaacaagaagttttatggtccgtgattaatctttccattgatggtgatgagct
tcattatgatattgaggacctaactaatgtaccgtttctaaaggatgaccatcatgaagtagagattcacggttattgcg
atgggattgtttgtgtaacagtacacgaaaatttctttttgtgcaatcctgcaacgagggaattcaggcaacttcctgat
tcataccttcttctaccccttcccggggtaaaagaaaaattcggattggaaacgacacttaaaggactgggatttggtta
tgattgcaaagccaaagaatacaaggttgtgcgaattatagataattatgattgtgagtattcagatgatggagaaacat
atatcgagcatattgctcttccttacactgctgaagtatacaccatggctgctaactcttggaaagagatcacgattgat
atattaagtaaaatattatcatcatttagcgaaccatattcttattcagtgtatttgaaagggttttgttattggttgtc
atgcgatgtagaggaatacatattttcatttgatttagctaatgaaatatctgatatgatagaattgccttataggggag
aattcggttttaagcgtgatggtatttttctgtataatgaatccctcacttattattgcactagttacgaagagccttcc
acattatttgaaatatgggtaatggactacgatgaaggatttaagagtttatggacaaaac
back to top
>KC701697.1-SFBB8.m1861
gttttgtggccaaacacctcagcgattctgtggacaacaaactctcatcctccacttgtatccttctcaactgctctcag
gctcacgtttgctcggaagagagttggaaacaagaagttttatggtccgtgattaatctttccattgatggtgatgagct
tcattatgatattgaggacctagctaatgtaccgtttctaaaggatgaccatcatgaagtagagattcacggttattgcg
atgggattgtttgtgtaacagtaaaggaaaatttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgat
tcatgccttcttctaccccttcccggggtaaaagaaaaattcggattggaaacgacacttaaaggactgggatttggtta
tgattgcaaagctaaagaatacaaggttgtgcgaattatagataattatgattgtgagtattcagatgatggagaaacat
atatcgagcatattgctcttccttacactgctgaagtatacaccatggctgctaactcttggaaagagatcacgattgat
atattaagtaaaatattatcatcatatagcgaaccatattcttgttcagtgtatttgaaagggttttgttattggttgtc
atgcgatcaagaggaatacatattttcatttgatttagctaatgaaatatctgatatgatagaattgccttttaggggag
aattcggttttaagcgtgatggtatttttctgtataatgaatccctcacttattattgcactagttacgaagagccttcc
acattatttgaaatatgggtaatggactatgatgacggatttaagagttcatggacaaaac
back to top
>KC701696.1-SFBB8.m1861
gttttgtggccaaacacctcagcgattctgtggacaacaaactctcatcctccacttgtatccttctcaactgttctcag
gctcacgtttgctcggaagagagttggaaacaagaagttttatggtccgtgattaatctttccattgatggtgatgagct
tcattatgatattgaggacctaactaatgtaccgtttctaaaggatgaccatcatgaagtagagattcacggttattgcg
atgggattgtttgtgtaacagtaaaggaaaatttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgat
tcatgccttcttctaccccttcccggggtaaaagaaaaattcggattggaaacgacacttaaaggactgggatttggtta
tgattgcaaagctaaagaatacaaggttgtgcgaattatagataattatgattgtgagtattcagatgatggagaaacat
atatcgagcatattgctcttccttacactgctgaagtatacaccatggctgctaactcttggaaagagatcacgattgat
atattaagtaaaatattatcatcatatagcgaaccatattcttattcagtgtatttgaaagggttttgttattggttgtc
atgcgatgtagaggaatacatattttcatttgatttagctaatgaaatatctgatatgatagaattgccttataggggag
aattcggttttaagcgtgatggtatttttctgtataatgaatccctcacttattattgcactagttacgaagagccttcc
acattatttgaaatatgggtaatggactacgatgacggatttaaaagtgcatggacaaaac
back to top
>KC701695.1-SFBB8.m1861
gttttgtggccaaacacctcagcgattctgtggacaacaaactctcatcctccacttgtatccttctcaactgttctcag
gctcacgttggttcggaagagagttggaaacaagaagttttatggtccgtgattaatctttccattgatggtgatgagct
tcattatgatattgaggacctaactaatgtaccgtttctaaaggatgaccatcatgaagtagagattcacggttattgcg
atgggattgtctgtgtaacagtagaggaaaatttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgac
tcatgccttcttctaccccttcccggggtaaaagaaaaattcggattggaaacgacacttaaaggactgggatttggtta
tgattgcaaagctaaagaatacaaggttgtgcgaattatagataattatgattgtgagtattcagatgatggagaaacat
atatcgagcatattgctcttcctcacactgctgaagtatacaccatggctgctaactcttggaaagagatcacgattgat
atattaagtaaaatattatcatcatatagcgaaccatattcttgttcagtgtatttgaaagggttttgttattggttgtc
atgcgatcaagaggaatacatattttcatttgatttagctaatgaaatatctgatatgatagaattgccttttaggggag
aattcggttttaagcgtgatggtatttttctgtataatgaatccctcacttattattgcactagttacgatgagccttcc
acattatttgaaatatgggtaatggactacgatgacggatttaagagttcatggacaaaac
back to top
>KC701658.1-SFBB8.m1852
aaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctgtggacaa
cagactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaagagagttggaaacaagaag
ttttatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatgtaccgttt
ctaaaggatgatcatcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaaatttctt
tttgtgcaatcctgcaacgagagaattcaggcaacttcctgactcatgccttcttctaccccttcccggggtaaaagaaa
aattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagccaaagaatacaaggttgtgcgaatt
atagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttccttacactgctgaagt
atacaccatggctgctaactcttggaaagagatcacgattgatatattaagtaaaatattatcatcatatagtgaaccat
attcttattcagtgtatttgaaagggttttgttattggttgtcatgcgatgtagaggaatacatattttcatttgattta
actaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttctgcataa
tgaatccctcacttattattgcactagttacgaagagccttccacattattt
back to top
>KC701657.1-SFBB8.m1852
aaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctgtggacaa
cagactctcatcctccacttgtatccttcttaactgttctcaggctcacgtttgctcggaagagagttggaaacaagaag
ttttatggtctgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatgtaccgttt
ctaaaggacgaccatcatgaattagagattcacggttattgcgatgggattgtttgtgtaacagtaaacgaaaatttctt
tttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggtaaaagaaa
aattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgtgcgaatt
atagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttcctcacactgctgaagt
atacaccatggctactaactcttggaaagagatcacgattggtatattaagtaaaatattatcatcatatagcgaaccat
attcttgttcagtgtatttgaaagggttttgttattggttgtcatgcgatgaagaggaatacatattttcatttgattta
gctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttctgtataa
tgaatccctcacttattattgcactagttacgaagagccttccacattattt
back to top
>KC701615.1-SFBB8.m1852
aaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctgtggacaa
cagactctcatcctccacttgtatccttcttaactgttctcaggctcacgtttgctcggaagagagttggaaacaagaag
ttttatggtctgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatgtaccgttt
ctaaaggacgaccatcatgaattagagattcacggttattgcgatgggattgtttgtgtaacagtaaacgaaaatttctt
tttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggtaaaagaaa
aattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgtgcgaatt
atagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttcctcacactgctgaagt
atacaccatggctactaactcttggaaagagatcacgattggtatattaagtaaaatattatcatcatatagcgaaccat
attcttgttcagtgtatttgaaagggttttgttattggttgtcatgcgatgaagaggaatacatattttcatttgattta
gctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttctgtataa
tgaatccctcacttattattgcactagttacgaagagccttccacattattt
back to top
>KC701614.1-SFBB8.m1852
aaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctgtggacaa
caaactctcatcctccacttgtatccttctcaactgctctcaggctcacgtttgctcggaagagagttggaaacaagaag
ttttatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactaatataccgttt
ctaaaggatgatcatcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtaaaggaaaatttctt
tttgtgcaatcctgcaacgggggaattcagacaacttcctgattcatgccttcttctaccccttcccggggtaaaagaaa
aattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgtgcgaatt
atagataattatgattgtgagtattcagatgatggagaaacatatatcgagcatattgctcttccttacactgctgaagt
atacaccatggctgctaactcttggaaagagatcacgattgatatattaagtaaaatattatcatcatatagcgaaccat
attcttattcagtgtatttgaaagggttttgttattggttgtcatgcgatgtagaggaatacatattttcatttgattta
gctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaagcgtgatggtatttttctgtataa
tgaatccctcacttattattgcactagttacgaagagccttccacattattt
back to top