SFBB9-alpha, SFBB9-alpha (gene) Pyrus pyrifolia

Gene Overview
Name SFBB9-alpha
Gene Symbol SFBB9-alpha
Type gene
Organism Pyrus pyrifolia
Synonym SFBBalpha protein
SFBBbeta protein
Description NA
Comment S-locus F-box brother protein; SFBBalpha-Kum2
S-locus F-box brother protein; SFBBalpha-Kum1
S-locus F-box brother protein; SFBBbeta-Kum3
S-locus F-box brother protein; SFBBbeta-Kum2
S-locus F-box brother protein; SFBBbeta-Kum1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB9-alphaHM013907.1-SFBB9-alpha.m1Pyrus pyrifoliamRNA
SFBB9-alphaHM013906.1-SFBB9-alpha.m1Pyrus pyrifoliamRNA
SFBB9-alphaHM013910.1-SFBB9-alpha.m1Pyrus pyrifoliamRNA
SFBB9-alphaHM013909.1-SFBB9-alpha.m1Pyrus pyrifoliamRNA
SFBB9-alphaHM013908.1-SFBB9-alpha.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HM013907.1-SFBB9-alpha.m1 scaffold00905:17939..19118
HM013907.1
mRNA parsed from NCBI nr database HM013906.1-SFBB9-alpha.m1 scaffold00905:17939..19118
HM013906.1
mRNA parsed from NCBI nr database HM013910.1-SFBB9-alpha.m1 scaffold02780:22101..23267
HM013910.1
mRNA parsed from NCBI nr database HM013909.1-SFBB9-alpha.m1 scaffold00905:122821..124012
HM013909.1
mRNA parsed from NCBI nr database HM013908.1-SFBB9-alpha.m1 N/A HM013908.1

Sequence(s):
>HM013907.1-SFBB9-alpha.m11179
atgtcccaggtgcatgaaagtgaaactcctcaagataaggtggttgaaatcttgtccaggttgccgcccaagtccctgat
gagattcaaatgcgtacacaaatcatggtgcactatcatcaatagtccaagttttgtggccaaacacctcagcaataccg
tggacaacaaattctcatccttcacttgcatccttttcaaccgatctcaggttcatgttttcgcggacaggagttggaaa
agagatgttttctggtctacgattaatctttccattgaaagtgatgagcacaaccttcattatgatgtcaaggacctaaa
tataccctttcctatggaagttcaagacaatgtacagctttacggttactgcaatggaattgtctgtgtaatagtagggg
aaaatgttcttctatgcaatcctgcaacaagagaattcaagcaacttcccaattcatccctcctcctaccccttcccacg
ggaaaattcggattggaaacgctctttaaaggattgggattcggctatgattgcaaaactaaagaatataaggttgtgcg
aattatagaaaattgtgattgtgagtattcagaaggtaaagaatcatattatgagcgtattcttcttccctacacggctg
aggtatacaccgcggttgctaactcttggaaagagatcaagattgatacatcaagtgatactgatccgtattgcattccc
tattcttgttcagtgtacttgaagggattttgttattggtttgcaaacgataacggggaatacatattttcatttgattt
aggtgatgagatatttcatagaatagaattgccttttaggagagaatccgattttaatttttatggtctttttctgtata
aggaatccgtcgcttcttattgctctcgttacgaagaggattgtaaattgcttgaaatatgggtaatggacgactatgat
ggagtgaagagttcatggacaaaactcctaacagttggaccctttaaagacattgagtctccttcgacattttggaaatg
tgacgaggttcttatcctttcctcatatggaaaagccacctcttataattctagtaccggaaatctcaagtatcttcata
ttcctcctattatcaattggatgatagattatgtggaaactattgtcccagtcaagtga
back to top
>HM013906.1-SFBB9-alpha.m11179
atgtcccaggtgcatgaaagtgaaactcctcaagataaggtggtcgaaatcttgtccaggttgccgcccaagtccctgat
gagattcaaatgcgtacacaaatcatggtgcactatcatcaatagtccaagttttgtggccaaacacctcagcaataccg
tggacaacaaattctcatccttcacttgcatccttttcaaccgatctcaggttcatgttttcgcggacaggagttggaaa
agagatgttttctggtctatgattaatctttccattgaaagtgatgagcacaaccttcattatgatgtcaaggacctaaa
tataccctttcctatggaagttcaagacaatgtacagctgtacggttactgcaatggaattgtctgtgtaatagtagggg
gaaatgttcttctatgcaatcctgcaacaagagaattcaagcaacttcccgattcatcccttcttctaccccttcccacg
ggaagattcggattggaaacgctctttaaaggattgggatttggctatgattgcaaaactaaagaatataaggttgtgcg
aattatagaaaattgtgattgtgagtattcagaaggtaaagaatcatattatgagcgtattcttcttccctacacggctg
aggtatacaccacggctgctaaatcttggaaagagatcaagattgatacatcaagtgatactgatccgtattgcattccc
tattcttgttcagtgtacttgaagggattttgttattggtttgcaaacgataacggggaatacatattttcatttgattt
aggtgatgagatatttcatagaatagaattgccttttaggagagaatccgattttaatttttatggtctttttctgtata
atgaatctgtcgcttcttattgctctcgttatgaagaggattgtaaattgcttgaaatatgggtaatggacgacgatgat
ggagtgaagagttcatggacaaaactcctaacagttggaccctttaaagacattgagtctccttcgacattttggaaatg
tgacgaggttcttatcctttcctcatatggaaaagccacctcttataattctagtactggaaatctcaagtatcttcata
ttcctcctattatcaattggatgatagattatgtggaaactattgttccagtcaagtga
back to top
>HM013910.1-SFBB9-alpha.m11166
aaactcctgaagataaggtggttgaaattttgtccaggttgccacccaagtctctgatgcgattcaaatgcatacgcaag
tcttggtgcactctcatcaatggtccaagttttgtggccgaacacctcaacaattccgtggacagcaaacgctcgtccaa
cacttgtatccttctcaaccgttctcagatgcccgttttcccagacaacagttggaaatatgaagttttttggtccatga
ttagtctttccattgatagtgatgagcacaaccttcattatgatgttgaggacctaaatataccgtttccaatggaagac
catcatcctgtagtgattcacggtcattgcaatgggattgtctgtgtaataacagggaaaaatgttgttttatgcaatcc
tgcaattggggaattcaggcaacttcccgattgcctccttctaccccttcccaacataaaattccaattggagacgagct
ttggaggattgggattcggctatgattgcaaagctaaagaatacaaggttgtgcgaattacagaaaattgtgagtattca
gatgctgaacgaacatattaccatcgtattgatcttcctcatacggctcaggtatacaccacgactgctaactcttggaa
agagatcaagattgatatatcaagtaaaagctatcttgattcttgtccagtgtacttgaagggattttgttattggattg
caaatgatggcgaggaattcatactttcatttgatttaagtgatgagatatttcatagaatacaaatgcctcttgggaga
gaatccagtttgcagttttgtaatctttttttgtataatgaatccctcgcttgtttttgctctctttacggtccaagtgg
caattctagattatttgaaatatttgaaatatgggtaatggacgactatcacggagttaagagttcatggacaaaacttc
tagccattggaccctttaagcacaatgagaatccattgacattttggaaaagtgacgagtttcttatggttacctcagat
agaagagtcacctcttataattcaagtaccggaaatctcaagtatcttcttattcctcctattatgaatgaggttataga
tttacaagctcttatttatgtggaaagtattgttccagtcaactga
back to top
>HM013909.1-SFBB9-alpha.m11191
atgacccatgtacgtgcaagtgaaatccttgaagatagggtggccgaaatcctgtccaggttgctaccaaagtctctgat
gcggttcaaatgtatacgcaagtcttggtgcacggtcatcaacaatccaagttttatggccaaacacctcagcaattccg
ttgacaacaaattctcatcctccacttgtatccttctccgccgttctcagatgcccgttttcccggacagaagttggaaa
cgagaatatttctggtccatgattaatctttcccatgatagtgatgagcacaacctttattacgatgttgaggacctaaa
tatacaatttccattggaagatcatgatcatgtatcgattcatggctattgcaatgggattgtctgtctaatagtaggga
aaaatgctgttttatacaatcctgcaacgagggaactgaagcaactacctgattcatgccttcttctaccctcccctccg
gagggaaaattcgaattggaatcgacctttcaaggaatgggatttggctatgatagcaaagctaatgagtacaaggttgt
gaaaattatagaaaattgtgagtattcagatgatatgcgaacattttctcattgtattgctcttcctcacacgactgagg
tatatgtcacgactactaactcttggagagtgatcgagattgaaatatcaagtgatacctataattgttcttgttcagta
tacttgaaaggattttgttattggtttgcaagcgatgacgaggaatacgtactttcacttgatttaggtgatgagatatt
tcatagaatacaattgccttataggaaagaatccggttttttgttttatgatctttttctgtataatgaatccatcgctt
ctttttgctctcattatgataatgacaattctggaatattggaaatacttgaaatatgggtaatgaacgactgtgacgga
gttaagagttcatggacaaaactactaacccttggaccctttgaagacaatgagaatttattaacattttggaaaagtga
tgagcttcttatggttacctccgataaaagagccatttcttataattctagtaccggaaatcttaagtatattcatattc
ctcctattatgaataaggttacagatttcgaagctcttatttatgtgaaaagtattgtttcagtcaagtga
back to top
>HM013908.1-SFBB9-alpha.m11194
atgacccaggtacgtgaaagtgaaactcctgaagatagggtggccgaaatcctgtccaggttgcctccaaagtctctgat
gcggttcaaatgtatacgcaagtcttggggcacgatcatcaacaatccaagttttatggccaaacacctcagcaattccg
ttgacaacaaattctcatcctccacttgtatccttctccgccggtctcagatgcccgttttcccggacagaagttggaaa
cgagaacatttctggtccatgattaatctttcccatgatagtgatgagcacaacctttattatgatgttgaggacctaaa
tatacaatttccattggaagatcatgatcatgtatcgattcatggctattgcaatgggattgtctgtctaatagtaggga
aaaatgctgttttatacaatcctgcaacgagggaactgaagcaactacctgattcatgccttcttctaccttcccctccg
gagggaaaattcgaattggaatcgacctttcaaggaatgggatttggctatgatagcaaagctaaagaatacaaggttgt
gaaaattatagaaaattgtgagtactcagatgatcaacgaacattttctcatcgtattgctcttcctcacacggctgagg
tatatgtcacgactactaactcttggagagtgatcgagattgaaatatcaagtgatacctataactgttcttgttcagta
tacttgaagggattttgttattggtttgcaagcgatgatgaggaatacatactttcatttgatttaggtgatgaaatatt
tcatagaatacaattgccttataggaaagaatccggttttttgttttatgatttttttctgtataatgaatccatcgctt
ctttttgctctcattatgataaaagtgacaattctggaatattggaaatacttgaaatatggataatggacgattgtgat
ggagtcaagagctcatggacaaaactacaaacccttggaccctttaaaggcaatgagaatttattgacattttggaaaag
tgacgagtttcttatggttacctctgataaaagagtcatctcttataattctagtactggaaatctcaagtatattcata
ttcctcctattatcaatacggttgcagatttcgaagctcttatttacgtggaaagtattgtttcagtccagtga
back to top