SFBB9-beta, SFBB9-beta (gene) Malus x domestica

Gene Overview
Name SFBB9-beta
Gene Symbol SFBB9-beta
Type gene
Organism Malus x domestica
Synonym Psi-SFBB9-beta
MdSFBB9-beta
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB9-betaAB270794.1-SFBB9-betaMalus x domesticagene
SFBB9-betaAB270792.1-SFBB9-betaMalus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB9-betaAB270794.1-SFBB9-beta.m1Malus x domesticamRNA
SFBB9-betaAB270792.1-SFBB9-beta.m4Malus x domesticamRNA
SFBB9-betaAB270792.1-SFBB9-beta.m5Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB270794.1-SFBB9-beta N/A AB270794.1
gene parsed from NCBI nr database AB270792.1-SFBB9-beta N/A AB270792.1
mRNA parsed from NCBI nr database AB270794.1-SFBB9-beta.m1 N/A AB270794.1
mRNA parsed from NCBI nr database AB270792.1-SFBB9-beta.m4 N/A AB270792.1
mRNA parsed from NCBI nr database AB270792.1-SFBB9-beta.m5 N/A AB270792.1

Sequence(s):
>AB270794.1-SFBB9-beta1179
atgtctcaggtgcgtgaaagtgaaactcttgaagataaggtggttgaaatcctgtccaagttgccgcccaagtctctgat
gagattcaaatgcatacgcaagtcttggtgcactatcatcaatagtccaagttttgtggccaaacacctcaacaattcca
tggactacaaactctcgtccaccacttgtatccttctcaaccgttgtcaggttcatgttttcccggacaggagttggaaa
caagacgttttctggtccatgattaatctttccattgatagtgatgagcacaaccttcattatgatgttgaggacataaa
tataccgtttccaatggaagatcaagacaatgtagagcttcacggttactgcaatgggattgtctgtgtaatagtaggga
aaaatgttcttttatgcaatcctgcaacgggagaattcaggcaacttcccaattcacctcttcttctaccccttcccaag
ggaagattcggattggaaacgacttttaaaggaatgggatttggctatgattgcaaaagtaaagaatacaaggttgtgcg
aataatagaaaattgtgattgtgagtattcagatgatggagaatcatactatgagcgtattcttcttcctcacacggctg
aggtatacaccatgactgctaactcttggaaagagatcaagattgatatatcaattgaaactcgttggtattgcattccg
tattctggttcagtgtacttgaatggattttgttattggtttgcatatgataacggggagtacgtattttcatttgattt
aggtgatgagatatttcataaaatagacttgccttctaggagagaatccgattttaagttttatggtatttttctgtata
atgaatctgtcacttcatattgctatcgtcacgaagaggattgtgaattatttgaaatatgggtaatggacgactatgat
ggagttaagagttcatggacaaaactactaacgattggaccccttaaagacatcgattatccattgacactttggaaatg
tgacgaggttcttatgcttggctcatatggaagagcagcctcttgtaattctagtaccggaaatcttaggtatcttcata
ttcctcctattatcaagtggatgatggattatgtgaaaagtattgttccagtccagtga
back to top
>AB270792.1-SFBB9-beta1179
atgtctcaggtgcgtgaaagtgaaactcttgaagataaggtggttgaaatcctgtccaagttgccgcccaagtctctgat
gagattcaaatgcatacgcaagtcttggtgcactatcatcaatagtccaagttttgtggccaaacacctcaacaattcca
tggactacaaactctcgtccaccacttgtatccttctcaaccgttgtcaggttcatgttttcccggacaggagttggaaa
caagacgttttctggtccatgattaatctttccattgatagtgatgagcacaaccttcattatgatgttgaggacataaa
tataccgtttccaatggaagatcaagacaatgtagagcttcacggttactgcaatgggattgtctgtgtaatagtaggga
aaaatgttcttttatgcaatcctgcaacgggagaattcaggcaacttcccaattcacctcttcttctaccccttcccaag
ggaagattcggattggaaacgacttttaaaggaatgggatttggctatgattgcaaaagtaaagaatacaaggttgtgcg
aataatagaaaattgtgattgtgagtattcagatgatggagaatcatactatgagcgtattcttcttcctcacacggctg
aggtatacaccatgactgctaactcttggaaagagatcaagattgatatatcaattgaaactcgttggtattgcattccg
tattctggttcagtgtacttgaatggattttgttattggtttgcatatgataacggggagtacgtattttcatttgattt
aggtgatgagatatttcataaaatagacttgccttctaggagagaatccgattttaagttttatggtatttttctgtata
atgaatctgtcacttcatattgctatcgtcacgaagaggattgtgaattatttgaaatatgggtaatggacgactatgat
ggagttaagagttcatggacaaaactactaacgattggaccccttaaagacatcgattatccattgacactttggaaatg
tgacgaggttcttatgcttggctcatatggaagagcagcctcttgtaattctagtaccggaaatcttaggtatcttcata
ttcctcctattatcaagtggatgatggattatgtgaaaagtattgttccagtccagtga
back to top
>AB270794.1-SFBB9-beta.m11179
atgtctcaggtgcgtgaaagtgaaactcttgaagataaggtggttgaaatcctgtccaagttgccgcccaagtctctgat
gagattcaaatgcatacgcaagtcttggtgcactatcatcaatagtccaagttttgtggccaaacacctcaacaattcca
tggactacaaactctcgtccaccacttgtatccttctcaaccgttgtcaggttcatgttttcccggacaggagttggaaa
caagacgttttctggtccatgattaatctttccattgatagtgatgagcacaaccttcattatgatgttgaggacataaa
tataccgtttccaatggaagatcaagacaatgtagagcttcacggttactgcaatgggattgtctgtgtaatagtaggga
aaaatgttcttttatgcaatcctgcaacgggagaattcaggcaacttcccaattcacctcttcttctaccccttcccaag
ggaagattcggattggaaacgacttttaaaggaatgggatttggctatgattgcaaaagtaaagaatacaaggttgtgcg
aataatagaaaattgtgattgtgagtattcagatgatggagaatcatactatgagcgtattcttcttcctcacacggctg
aggtatacaccatgactgctaactcttggaaagagatcaagattgatatatcaattgaaactcgttggtattgcattccg
tattctggttcagtgtacttgaatggattttgttattggtttgcatatgataacggggagtacgtattttcatttgattt
aggtgatgagatatttcataaaatagacttgccttctaggagagaatccgattttaagttttatggtatttttctgtata
atgaatctgtcacttcatattgctatcgtcacgaagaggattgtgaattatttgaaatatgggtaatggacgactatgat
ggagttaagagttcatggacaaaactactaacgattggaccccttaaagacatcgattatccattgacactttggaaatg
tgacgaggttcttatgcttggctcatatggaagagcagcctcttgtaattctagtaccggaaatcttaggtatcttcata
ttcctcctattatcaagtggatgatggattatgtgaaaagtattgttccagtccagtga
back to top
>AB270792.1-SFBB9-beta.m41179
atgtctcaggtgcgtgaaagtgaaactcttgaagataaggtggttgaaatcctgtccaagttgccgcccaagtctctgat
gagattcaaatgcatacgcaagtcttggtgcactatcatcaatagtccaagttttgtggccaaacacctcaacaattcca
tggactacaaactctcgtccaccacttgtatccttctcaaccgttgtcaggttcatgttttcccggacaggagttggaaa
caagacgttttctggtccatgattaatctttccattgatagtgatgagcacaaccttcattatgatgttgaggacataaa
tataccgtttccaatggaagatcaagacaatgtagagcttcacggttactgcaatgggattgtctgtgtaatagtaggga
aaaatgttcttttatgcaatcctgcaacgggagaattcaggcaacttcccaattcacctcttcttctaccccttcccaag
ggaagattcggattggaaacgacttttaaaggaatgggatttggctatgattgcaaaagtaaagaatacaaggttgtgcg
aataatagaaaattgtgattgtgagtattcagatgatggagaatcatactatgagcgtattcttcttcctcacacggctg
aggtatacaccatgactgctaactcttggaaagagatcaagattgatatatcaattgaaactcgttggtattgcattccg
tattctggttcagtgtacttgaatggattttgttattggtttgcatatgataacggggagtacgtattttcatttgattt
aggtgatgagatatttcataaaatagacttgccttctaggagagaatccgattttaagttttatggtatttttctgtata
atgaatctgtcacttcatattgctatcgtcacgaagaggattgtgaattatttgaaatatgggtaatggacgactatgat
ggagttaagagttcatggacaaaactactaacgattggaccccttaaagacatcgattatccattgacactttggaaatg
tgacgaggttcttatgcttggctcatatggaagagcagcctcttgtaattctagtaccggaaatcttaggtatcttcata
ttcctcctattatcaagtggatgatggattatgtgaaaagtattgttccagtccagtga
back to top
>AB270792.1-SFBB9-beta.m52249
atgtcccaggggcataaaagtgaaactcctcaagatatggtggtcgaaatcttatccaggttgccgcctaagtctctgat
gcgattccaatgcatatgcaagtcttggtgcaccctcatcaatagtccaagttttgtggccaaacaccttagtagttcca
tggacaacaaactctcatcctccaatggtatccttctcaaccgttctcaggttcacattttcccggaccagagttggtgt
aaacacggaaattcctgaaacaaacgagacaagaacacgtgtacaaaataatattttgtattaatgattttgggtttaca
atctctcccaaatttgatcctctgattcgatctccgtaaggcgttgatttgtggatgtgtgattgatccaagggccgtcg
aggcttgatcttggatgaacgattgaaagtttcttcaagggccgttggggcttgatcttgacggttgatgaacggatctt
caaggggcttttgggcttgatcttgaagaacagttgtgcggatttcttcaaggggcttttgggcttgatcttgaagaaca
gtgatgaacggatctttaaggggcttttgggcttgatcctgatgaacagttggatgtgtggatttgttgatgttgttgat
ccaaagggccattggggcttgatcttaggatgaacggatgatgaacgatgaacactttcttcaagggccgtcggggcttg
atcttgaattggtggaagttcttcaagggccgtcgaggcttgatcttgaattggtggaagttcttcaagggccgtagggg
cttggtcttgaaggaggatttgacgaagaatgaagaggggctttcttgatccttcgggatttcttgggaatttaggaggt
tggatgcttgaaagctttagaacttcgaagcttcaaggatttagggaattctcttccaatttgggagtagataaatgtat
atgtgaattcccctaaaatgaatgaaatggcttctatttatagaatttttcaaggcttaattttgaatataatattcaaa
tgaaataaatcgtttctgtcaggtgttgacacgtgtcctgtttgatgactttttcgatttattttgatttttcgtttagt
cacacgctacatgtaaaatttatatgacacatgagcgttgaaattgtaactattggttaacatttatttcactgaaattt
cgatgtctacagttggaaatgagaatttttctggtccatgatttatctatccattgatagtgatgagcacaacctttatc
atgatgttgaggacctaaatataccgtttccattggaaaatcatgaacatgtatcgattatcggttattgcaatgggatt
gtctgtctaatagtagggaaaaattctcctttatgtaatacagcaacgagggaatttaggcaacttccagattttctacc
ttctcctccccgagggaaagttcgaattggaatcgacccttcaaggaatgggatttggctatgattgcaaagctaaagaa
tacaaggttgtgaaaataatagaaaattgtgagtattcagatgataaacgaacatattatcatcgtattgatcttcctca
cactgcagaggtatacaccatggctgctaactcttagaaagagatcaacttatacctaccattgtccttgttcagtgtac
ttgaagggattttgttattggtttgcaagcaatggcgaggaatacatactttcatttgagttaggtgatgagatatttca
tataatacgattgtcttctagaagagaatccggttttatagaagagaatccggttttacgttcgataatatgtttttgta
taatgaatccatcgcttcattttgctctccttaccatccaagtgaggattctggattattggaagtacttgaaatatggg
taatggacaactatgaaggagctaagagatcatggacaaaactcctaaccgttggaccccttaaaggcaatgagaaccta
ttgacagtttggaaaagtgacaagcttcttatggttacctccgataaaagagtcatctcttataattctagtagtggaaa
tgtcaagtatcttcatattcctcctattatcaatgaggttatagatttccaagctcttatatatgtggaaagtattcgag
tcggatctcgtcccttgcacagctccctggggctctcgctctctcttgcatattgggcaaggttcgctgcttggtgtgtt
gcaatgtga
back to top