SFBB9, SFBB9 (gene) Sorbus aucuparia

Gene Overview
Name SFBB9
Gene Symbol SFBB9
Type gene
Organism Sorbus aucuparia
Synonym SFBB9
Description NA
Comment allele linked with Sc-RNase
allele linked with S22-RNase
allele linked with Sa-RNase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB9KC701702.1-SFBB9Sorbus aucupariagene
SFBB9KC701701.1-SFBB9Sorbus aucupariagene
SFBB9KC701700.1-SFBB9Sorbus aucupariagene
SFBB9KC701699.1-SFBB9Sorbus aucupariagene
SFBB9KC701656.1-SFBB9Sorbus aucupariagene
SFBB9KC701645.1-SFBB9Sorbus aucupariagene
SFBB9KC701629.1-SFBB9Sorbus aucupariagene
SFBB9KC701621.1-SFBB9Sorbus aucupariagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB9KC701702.1-SFBB9.m1Sorbus aucupariamRNA
SFBB9KC701701.1-SFBB9.m1Sorbus aucupariamRNA
SFBB9KC701700.1-SFBB9.m1Sorbus aucupariamRNA
SFBB9KC701699.1-SFBB9.m1Sorbus aucupariamRNA
SFBB9KC701656.1-SFBB9.m1Sorbus aucupariamRNA
SFBB9KC701645.1-SFBB9.m1Sorbus aucupariamRNA
SFBB9KC701629.1-SFBB9.m1Sorbus aucupariamRNA
SFBB9KC701621.1-SFBB9.m1Sorbus aucupariamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBSorbus aucupariagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KC701702.1-SFBB9 N/A KC701702.1
gene parsed from NCBI nr database KC701701.1-SFBB9 N/A KC701701.1
gene parsed from NCBI nr database KC701700.1-SFBB9 N/A KC701700.1
gene parsed from NCBI nr database KC701699.1-SFBB9 N/A KC701699.1
gene parsed from NCBI nr database KC701656.1-SFBB9 N/A KC701656.1
gene parsed from NCBI nr database KC701645.1-SFBB9 N/A KC701645.1
gene parsed from NCBI nr database KC701629.1-SFBB9 N/A KC701629.1
gene parsed from NCBI nr database KC701621.1-SFBB9 N/A KC701621.1
mRNA parsed from NCBI nr database KC701702.1-SFBB9.m1 N/A KC701702.1
mRNA parsed from NCBI nr database KC701701.1-SFBB9.m1 N/A KC701701.1
mRNA parsed from NCBI nr database KC701700.1-SFBB9.m1 N/A KC701700.1
mRNA parsed from NCBI nr database KC701699.1-SFBB9.m1 N/A KC701699.1
mRNA parsed from NCBI nr database KC701656.1-SFBB9.m1 N/A KC701656.1
mRNA parsed from NCBI nr database KC701645.1-SFBB9.m1 N/A KC701645.1
mRNA parsed from NCBI nr database KC701629.1-SFBB9.m1 N/A KC701629.1
mRNA parsed from NCBI nr database KC701621.1-SFBB9.m1 N/A KC701621.1

Sequence(s):
>KC701702.1-SFBB9543
aatcagatgcacgttttcccggaccagagttggaaatatgaaactttatggtccatgatgaatctttccaattatggtga
taagcagaaccttcattatgatttcaaggacctaaatataccgtttccaatggaagaccatcaacctgtgcaaattcaca
gttattgcaatggtattgtatgtgtaataacagggaaaggtacttgtattttatgcaatcctgcaacacgggaattcagg
caacttcctgattcatgccttcttctaccttcccctccggagggaaaatttcaattggagacggtctttgaaggattagg
attcggctatgattacaaagctaaagaatacaaggttgtgcaaattatagaaaattgtgagtatatagatgatgagcgaa
gatattatcatcgtattgctcttcctcacacggctgaggtatacaccactgctgctaactcttggaaagaggtcaagatt
gagatatcaagtaaaacctatcactgttatggttcacaatacttgaagggattttgttattgg
back to top
>KC701701.1-SFBB9543
actcagatgcacgttttcccggaccagagttggaaatatgaaactttatggtccatgatgaatctttccaattatagtga
tgagcacaaccttcattatgattttaaggacctaaatataccgtttccaacggaagaccatcatcctgtgcaaattcaca
gttattgcaatggtattgtctgtgtaataacagggaaaagtgttcgtattttatgcaatcctgcaacacgggaattcagg
caacttcctgcttcatgccttcttctaccttcccctccagagggaaaattccaattggagacgatctttgaaggattagg
attcggctatgattacaaagctaaagaatacaaggttgtgcaaattatagaaaattgtgagtattcagatgatgaacgaa
gatattatcatcgtattgctcttcctcacacggctgaggtatacaccacgtctgctaactcttggaaagagattaagatt
gagatatcaaataaaacctatcagtgttatggttcagaatacttgaagggattttgttattgg
back to top
>KC701700.1-SFBB9543
aatcagatgcacgttttcccggaccagagttggaaatatgaaactttatggtccatgatgaatctttccaattatagtga
tgagcacaaccttcattatgattttaaggacctaaatataccgtttccaacggaagaccatcatcctgtgcaaattcacg
gttattgcaatggtattgtatgtgtaataacagggaaaggtacttgtattttatgcaatcctgcaacacgggatttcagg
caacttcctgattcatgccttcttctaccttcccctccggagggaaaatttcaattggagacggtctttgaaggattagg
attcggctatgattacaaagctaaagaatacaaggttgtgcaaattatagaaaattgtgagtattcagatgatgagcgaa
gatattatcatcgtattgctcttcctcacacggctgaggtatacaccacagctgctaactcttggaaagagatcaagatt
gagatatcaagtaaaacctatcactgctatggttcagaatacttgaagggattttgttattgg
back to top
>KC701699.1-SFBB9543
actcagatgcacgttttcccggaccagagttggaaatatgaaactttatggtccatgatgaatctttccaattatagtga
tgagcataaccttcattatgattttaaggacctaaatataccgtttccaacggaagaccatcatcctgtgcaaattcaca
gttactgtaatggtattgtatgtgtaataacggggaaaagtgttcgtattttatgcaatcctgcaacacgggaattcagg
caacttcctgattcatgccttcttctaccttcccctccggagggaaaattccaattggagacgatccttgaaggattagg
attcggctatgattacaatgctaaagaatacaaggttgtgcaaattatagaaaattgtgagtattcggatgacgagcgaa
ggtattatcatcgtattgctcttcctcacacggctgaggtatacaccacggctgctaactcttggaaagagatcaagatt
gagatatcaagtaaaacctatcagtgttatggttcagaatacttgaatggattttgttattgg
back to top
>KC701656.1-SFBB9843
aaatgcatacgcaagtcttggtgcactctcatcaatagtccaagttttgtggccaaatacctcagcaattccgtggacaa
caaactctcatcctccacttgtatccttctcaaccgtactcagatgcatgttttcccggaccagagttggaaatatgaaa
ctttatggtccatgatgaatctttccaattatagtgatgagcacaatcttcattatgattttaaggacctaaatataccg
tttccaacggaagaccatcatcctgtgcaaattcacagttattgcaatggtattgtatgtgtaataacggggaaaagtgt
tcgtattttatgcaatcctgcaacacgggaattcaggcaacttcctgcttcatgccttcttctaccttcccctccagagg
gaaaattccaattggagacgatctttgaaggattaggattcggctatgattacaaagctaaagaatacaaggttgtgcaa
attatagaaaattgtgagtattcagatgatgagcgaagatattatcatcgtattgctcttcctcacacggctgaggtata
caccacgactgctaactcttggaaagagattaagattgagatatcaagtaaaacctatcagtgttatggttcagaatacg
tgaagggattttgttattggcttgcaaatgatggcgaggaatacatactttcatttgatttaggtgatgaaatatttcat
ataatacaattgccttctaggagagattctggttttaaattttataatatttttctgtgtaatgaatccattgcttcgtt
ttgctgttgttatgatccaaagaatgaggattctacattatgt
back to top
>KC701645.1-SFBB9843
aaatgcatacgcaagtcttggtgtactctcatcaatagtccaagttttgtggccaaatacctcggcaattccgtggacaa
caaactctcatcctccacttgtatccttctcaaccgtactcagatgcacgtttttccggaccagagttggaaatatgaaa
ctttatggtccatgatgaatctttccaattatagtgatgagcacaaccttcattatgattttaaggacctaaatataccg
tttccaacggaagaccatcatcctgtgcaaattcacagttattgcaatggtattgtatgtgtaataacagggaagagtgt
tcgtattttatgcaatcctgcaacacgggaattcaggcaacttcctgattcatgccttcttctaccttcccttctggagg
gaaaattccaattggagacgacctttgaaggattaggattcggctatgattacaaagctaaagaatacaaggttgtgcag
attatagaaaattgtgagtattcagatgatgagcgaagatattatcatcgtattgctcttcctcacacggctgaggtata
caccacggctgctaactcttggaaagagatcaagattgagatatcaagtaaaacctatcagtgttatggttcagaatact
tgaagggattttgttattggcttgcaaacgatggcgaggaatacatactttcatttgatttaggtgatgaaatatttcat
ataatacaattgccttctaggagagaatctggttttaaattttataatatttttctgtgtaatgaatccgttgcttcatt
ttgctgttgttatgatccaaagaatgaggattctacattatgt
back to top
>KC701629.1-SFBB9843
aaatgcatacgcaagtcttggtgtactctcatcaatagtccaagttttgtggccaaatacctcggcaattccgtggacaa
caaactctcatcctccacttgtatccttctcaaccgtactcagatgcacgtttttccggaccagagttggaaatatgaaa
ctttatggtccatgatgaatctttccaattatagtgatgagcacaaccttcattatgattttaaggacctaaatataccg
tttccaacggaagaccatcatcctgtgcaaattcacagttattgcaatggtattgtatgtgtaataacagggaagagtgt
tcgtattttatgcaatcctgcaacacgggaattcaggcaacttcctgattcatgccttcttctaccttcccttctggagg
gaaaattccaattggagacgacctttgaaggattaggattcggctatgattacaaagctaaagaatacaaggttgtgcag
attatagaaaattgtgagtattcagatgatgagcgaagatattatcatcgtattgctcttcctcacacggctgaggtata
caccacggctgctaactcttggaaagagatcaagattgagatatcaagtaaaacctatcagtgttatggttcagaatact
tgaagggattttgttattggcttgcaaacgatggcgaggaatacatactttcatttgatttaggtgatgaaatatttcat
ataatacaattgccttctaggagagaatctggttttaaattttataatatttttctgtgtaatgaatccgttgcttcatt
ttgctgttgttatgatccaaagaatgaggattctacattatgt
back to top
>KC701621.1-SFBB9843
aaatgcatacgcaagtcttggtgcactctcatcaatagtccaagttttgtggccaaatatctcagcaattccgtggacaa
caaactctcatcctccacttgtatccttctcaaccgtactcagatgcacgttttcccggaccagagttggaaatatgaaa
ctttatggtccatgatgaatctttccaattatagtgatgagcacaaccttcattatgattttaaggacctaaatataccg
tttccaacggaagaccatcatcctgtgcaaattcacagttattgcaatggtattgtatgtgtaataacagggaaaagtgt
ttgtattttatgcaatcctgcaacacgggaattcaggcaacttcctgcttcatgccttcttctaccttcctctccagagg
gaaaattccaattggagacgatctttgaaggattaggattcggctatgattacaaagccaaagaatacaaggttgtgcaa
attatagaaaattgtgagtattcagatgatgagcgaagatattatcatcgtattgctcttcctcacacggctgaggtata
caccacgactgctaactcttggaaagagattaagattgagatatcaagtaaaacctatcagtgttatggttcagaatact
tgaagggattttgttattggcttgcaaacgatggcgaggaatacatactttcatttgatttaggtgatgaaatatttcat
ataatacaattgccttctaggagagaatctggttttaaattttataatatttttctgtgtaatgaatccattgcttcgtt
ttgctgttgttatgatccaaggaatgaggattcgacattatgt
back to top
>KC701702.1-SFBB9.m1543
aatcagatgcacgttttcccggaccagagttggaaatatgaaactttatggtccatgatgaatctttccaattatggtga
taagcagaaccttcattatgatttcaaggacctaaatataccgtttccaatggaagaccatcaacctgtgcaaattcaca
gttattgcaatggtattgtatgtgtaataacagggaaaggtacttgtattttatgcaatcctgcaacacgggaattcagg
caacttcctgattcatgccttcttctaccttcccctccggagggaaaatttcaattggagacggtctttgaaggattagg
attcggctatgattacaaagctaaagaatacaaggttgtgcaaattatagaaaattgtgagtatatagatgatgagcgaa
gatattatcatcgtattgctcttcctcacacggctgaggtatacaccactgctgctaactcttggaaagaggtcaagatt
gagatatcaagtaaaacctatcactgttatggttcacaatacttgaagggattttgttattgg
back to top
>KC701701.1-SFBB9.m1543
actcagatgcacgttttcccggaccagagttggaaatatgaaactttatggtccatgatgaatctttccaattatagtga
tgagcacaaccttcattatgattttaaggacctaaatataccgtttccaacggaagaccatcatcctgtgcaaattcaca
gttattgcaatggtattgtctgtgtaataacagggaaaagtgttcgtattttatgcaatcctgcaacacgggaattcagg
caacttcctgcttcatgccttcttctaccttcccctccagagggaaaattccaattggagacgatctttgaaggattagg
attcggctatgattacaaagctaaagaatacaaggttgtgcaaattatagaaaattgtgagtattcagatgatgaacgaa
gatattatcatcgtattgctcttcctcacacggctgaggtatacaccacgtctgctaactcttggaaagagattaagatt
gagatatcaaataaaacctatcagtgttatggttcagaatacttgaagggattttgttattgg
back to top
>KC701700.1-SFBB9.m1543
aatcagatgcacgttttcccggaccagagttggaaatatgaaactttatggtccatgatgaatctttccaattatagtga
tgagcacaaccttcattatgattttaaggacctaaatataccgtttccaacggaagaccatcatcctgtgcaaattcacg
gttattgcaatggtattgtatgtgtaataacagggaaaggtacttgtattttatgcaatcctgcaacacgggatttcagg
caacttcctgattcatgccttcttctaccttcccctccggagggaaaatttcaattggagacggtctttgaaggattagg
attcggctatgattacaaagctaaagaatacaaggttgtgcaaattatagaaaattgtgagtattcagatgatgagcgaa
gatattatcatcgtattgctcttcctcacacggctgaggtatacaccacagctgctaactcttggaaagagatcaagatt
gagatatcaagtaaaacctatcactgctatggttcagaatacttgaagggattttgttattgg
back to top
>KC701699.1-SFBB9.m1543
actcagatgcacgttttcccggaccagagttggaaatatgaaactttatggtccatgatgaatctttccaattatagtga
tgagcataaccttcattatgattttaaggacctaaatataccgtttccaacggaagaccatcatcctgtgcaaattcaca
gttactgtaatggtattgtatgtgtaataacggggaaaagtgttcgtattttatgcaatcctgcaacacgggaattcagg
caacttcctgattcatgccttcttctaccttcccctccggagggaaaattccaattggagacgatccttgaaggattagg
attcggctatgattacaatgctaaagaatacaaggttgtgcaaattatagaaaattgtgagtattcggatgacgagcgaa
ggtattatcatcgtattgctcttcctcacacggctgaggtatacaccacggctgctaactcttggaaagagatcaagatt
gagatatcaagtaaaacctatcagtgttatggttcagaatacttgaatggattttgttattgg
back to top
>KC701656.1-SFBB9.m1843
aaatgcatacgcaagtcttggtgcactctcatcaatagtccaagttttgtggccaaatacctcagcaattccgtggacaa
caaactctcatcctccacttgtatccttctcaaccgtactcagatgcatgttttcccggaccagagttggaaatatgaaa
ctttatggtccatgatgaatctttccaattatagtgatgagcacaatcttcattatgattttaaggacctaaatataccg
tttccaacggaagaccatcatcctgtgcaaattcacagttattgcaatggtattgtatgtgtaataacggggaaaagtgt
tcgtattttatgcaatcctgcaacacgggaattcaggcaacttcctgcttcatgccttcttctaccttcccctccagagg
gaaaattccaattggagacgatctttgaaggattaggattcggctatgattacaaagctaaagaatacaaggttgtgcaa
attatagaaaattgtgagtattcagatgatgagcgaagatattatcatcgtattgctcttcctcacacggctgaggtata
caccacgactgctaactcttggaaagagattaagattgagatatcaagtaaaacctatcagtgttatggttcagaatacg
tgaagggattttgttattggcttgcaaatgatggcgaggaatacatactttcatttgatttaggtgatgaaatatttcat
ataatacaattgccttctaggagagattctggttttaaattttataatatttttctgtgtaatgaatccattgcttcgtt
ttgctgttgttatgatccaaagaatgaggattctacattatgt
back to top
>KC701645.1-SFBB9.m1843
aaatgcatacgcaagtcttggtgtactctcatcaatagtccaagttttgtggccaaatacctcggcaattccgtggacaa
caaactctcatcctccacttgtatccttctcaaccgtactcagatgcacgtttttccggaccagagttggaaatatgaaa
ctttatggtccatgatgaatctttccaattatagtgatgagcacaaccttcattatgattttaaggacctaaatataccg
tttccaacggaagaccatcatcctgtgcaaattcacagttattgcaatggtattgtatgtgtaataacagggaagagtgt
tcgtattttatgcaatcctgcaacacgggaattcaggcaacttcctgattcatgccttcttctaccttcccttctggagg
gaaaattccaattggagacgacctttgaaggattaggattcggctatgattacaaagctaaagaatacaaggttgtgcag
attatagaaaattgtgagtattcagatgatgagcgaagatattatcatcgtattgctcttcctcacacggctgaggtata
caccacggctgctaactcttggaaagagatcaagattgagatatcaagtaaaacctatcagtgttatggttcagaatact
tgaagggattttgttattggcttgcaaacgatggcgaggaatacatactttcatttgatttaggtgatgaaatatttcat
ataatacaattgccttctaggagagaatctggttttaaattttataatatttttctgtgtaatgaatccgttgcttcatt
ttgctgttgttatgatccaaagaatgaggattctacattatgt
back to top
>KC701629.1-SFBB9.m1843
aaatgcatacgcaagtcttggtgtactctcatcaatagtccaagttttgtggccaaatacctcggcaattccgtggacaa
caaactctcatcctccacttgtatccttctcaaccgtactcagatgcacgtttttccggaccagagttggaaatatgaaa
ctttatggtccatgatgaatctttccaattatagtgatgagcacaaccttcattatgattttaaggacctaaatataccg
tttccaacggaagaccatcatcctgtgcaaattcacagttattgcaatggtattgtatgtgtaataacagggaagagtgt
tcgtattttatgcaatcctgcaacacgggaattcaggcaacttcctgattcatgccttcttctaccttcccttctggagg
gaaaattccaattggagacgacctttgaaggattaggattcggctatgattacaaagctaaagaatacaaggttgtgcag
attatagaaaattgtgagtattcagatgatgagcgaagatattatcatcgtattgctcttcctcacacggctgaggtata
caccacggctgctaactcttggaaagagatcaagattgagatatcaagtaaaacctatcagtgttatggttcagaatact
tgaagggattttgttattggcttgcaaacgatggcgaggaatacatactttcatttgatttaggtgatgaaatatttcat
ataatacaattgccttctaggagagaatctggttttaaattttataatatttttctgtgtaatgaatccgttgcttcatt
ttgctgttgttatgatccaaagaatgaggattctacattatgt
back to top
>KC701621.1-SFBB9.m1843
aaatgcatacgcaagtcttggtgcactctcatcaatagtccaagttttgtggccaaatatctcagcaattccgtggacaa
caaactctcatcctccacttgtatccttctcaaccgtactcagatgcacgttttcccggaccagagttggaaatatgaaa
ctttatggtccatgatgaatctttccaattatagtgatgagcacaaccttcattatgattttaaggacctaaatataccg
tttccaacggaagaccatcatcctgtgcaaattcacagttattgcaatggtattgtatgtgtaataacagggaaaagtgt
ttgtattttatgcaatcctgcaacacgggaattcaggcaacttcctgcttcatgccttcttctaccttcctctccagagg
gaaaattccaattggagacgatctttgaaggattaggattcggctatgattacaaagccaaagaatacaaggttgtgcaa
attatagaaaattgtgagtattcagatgatgagcgaagatattatcatcgtattgctcttcctcacacggctgaggtata
caccacgactgctaactcttggaaagagattaagattgagatatcaagtaaaacctatcagtgttatggttcagaatact
tgaagggattttgttattggcttgcaaacgatggcgaggaatacatactttcatttgatttaggtgatgaaatatttcat
ataatacaattgccttctaggagagaatctggttttaaattttataatatttttctgtgtaatgaatccattgcttcgtt
ttgctgttgttatgatccaaggaatgaggattcgacattatgt
back to top